Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

## Package Plan ##

environment location: /home/urbe/anaconda3

added / updated specs:
- salmon

The following packages will be downloaded:

package | build
---------------------------|-----------------
boost-1.64.0 | py36_4 331 KB conda-forge
jemalloc-5.1.0 | hfc679d8_0 8.2 MB conda-forge
boost-cpp-1.64.0 | 1 17.8 MB conda-forge
salmon-0.10.2 | 1 3.7 MB bioconda
conda-4.5.5 | py36_0 624 KB conda-forge
tbb-2018_20171205 | 0 1.2 MB conda-forge
------------------------------------------------------------
Total: 31.8 MB

The following NEW packages will be INSTALLED:

boost: 1.64.0-py36_4 conda-forge
boost-cpp: 1.64.0-1 conda-forge
jemalloc: 5.1.0-hfc679d8_0 conda-forge
salmon: 0.10.2-1 bioconda
tbb: 2018_20171205-0 conda-forge

The following packages will be UPDATED:

conda: 4.5.4-py36_0 conda-forge --> 4.5.5-py36_0 conda-forge

Proceed ([y]/n)? y

Downloading and Extracting Packages
boost-1.64.0 | 331 KB | ####################################################################################################################################### | 100%
jemalloc-5.1.0 | 8.2 MB | ####################################################################################################################################### | 100%
boost-cpp-1.64.0 | 17.8 MB | ####################################################################################################################################### | 100%
salmon-0.10.2 | 3.7 MB | ####################################################################################################################################### | 100%
conda-4.5.5 | 624 KB | ####################################################################################################################################### | 100%
tbb-2018_20171205 | 1.2 MB | ####################################################################################################################################### | 100%
Preparing transaction: done
Verifying transaction: done
Executing transaction: done

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

A list of programs for genotype and SNP calling :

SOAP2 http://soap.genomics.org.cn/index.html

Single-sample High-quality variant database (for example, dbSNP) Package for NGS data analysis, which includes a single individual genotype caller (SOAPsnp)

realSFS http://128.32.118.212/thorfinn/realSFS/

Single-sample Aligned reads Software for SNP and genotype calling using single individuals and allele frequencies. Site frequency spectrum (SFS) estimation

Samtools http://samtools.sourceforge.net/

Multi-sample Aligned reads Package for manipulation of NGS alignments, which includes a computation of genotype likelihoods (samtools) and SNP and genotype calling (bcftools)

GATK http://www.broadinstitute.org/gsa/wiki/index.php/The_Genome_Analysis_Toolkit Multi-sample Aligned reads Package for aligned NGS data analysis, which includes a SNP and genotype caller (Unifed Genotyper), SNP filtering (Variant Filtration) and SNP quality recalibration (Variant Recalibrator)

Beagle http://faculty.washington.edu/browning/beagle/beagle.html

Multi-sample LD Candidate SNPs, genotype likelihoods Software for imputation, phasing and association that includes a mode for genotype calling

IMPUTE2 http://mathgen.stats.ox.ac.uk/impute/impute_v2.html

Multi-sample LD Candidate SNPs, genotype likelihoods Software for imputation and phasing, including a mode for genotype calling. Requires fine-scale linkage map

QCall ftp://ftp.sanger.ac.uk/pub/rd/QCALL

Multi-sample LD ‘Feasible’ genealogies at a dense set of loci, genotype likelihoods Software for SNP and genotype calling, including a method for generating candidate SNPs without LD information (NLDA) and a method for incorporating LD information (LDA). The ‘feasible’ genealogies can be generated using Margarita (http://www.sanger.ac.uk/resources/software/margarita)

MaCH http://genome.sph.umich.edu/wiki/Thunder

Multi-sample LD Genotype likelihoods Software for SNP and genotype calling, including a method (GPT_Freq) for generating candidate SNPs without LD information and a method (thunder_glf_freq) for incorporating LD information

Address of the bookmark: http://samstat.sourceforge.net/

Qualifications : Ph. D.

Desirable : Experience on DNA Markers, plant genome mapping and bioinformatics

No. of Post : 03

Department : Genetics

Salary : Rs. 60,000/-
How to apply

The applicants are requested to register their names on the day of interview in the First Floor, Biotech Centre, Centre for Genetic Manipulation of Crop Plants, Department of Genetics before the stipulated time for the interview. Only the registered eligible candidates will be interviewed on the day in the Committee Room. Applicants are requested to bring all related documents, in original and a set of photocopy, for verification. Date and time of the interview : 25.06.2015 at 10:30 AM.

Click Here for Job Details http://www.du.ac.in/du/index.php?mact=News,cntnt01,detail,0&cntnt01articleid=5492&cntnt01returnid=83

Developper: Gaëtan Benoit, PhD, former member of the Genscale team at Inria.

Contact: claire dot lemaitre at inria dot fr

Simka and SimkaMin are comparative metagenomics method dedicated to NGS datasets. https://gatb.inria.fr/software/simka/

Address of the bookmark: https://github.com/GATB/simka

https://www.researchgate.net/job/939073_Senior_Scientist_Bioinformatics-Multi_Omics_Integration

Senior_Scientist_Bioinformatics-Transcriptomics_Analysis

https://www.researchgate.net/job/939075_Senior_Scientist_Bioinformatics-Transcriptomics_Analysis-Belgium_France_Switzerland_The_Netherlands

Senior Scientist Bioinformatics - Network Analytics

https://www.researchgate.net/job/939070_Senior_Scientist_Bioinformatics-Network_Analytics_Belgium_France_Switzerland_the_Netherlands

Team Leader Bioinformatics Data Sciences - Mechelen, Belgium

https://www.researchgate.net/job/938787_Team_Leader_Bioinformatics_Data_Sciences-Mechelen_Belgium