Address of the bookmark: https://kablammo.wasmuthlab.org/

Step 1: Install BLAST

1. Download BLAST:

   • Visit the NCBI BLAST+ download page to download the appropriate version for your operating system (Windows, macOS, or Linux).

2. Install BLAST:

   • Extract the downloaded archive. For Linux/Mac, use:

     tar -xvzf ncbi-blast-*.tar.gz
     cd ncbi-blast-*
     

   • Add the BLAST binary folder to your system PATH for easier access:

     export PATH=$PATH:/path/to/ncbi-blast-*/bin
     

3. Verify Installation:
   Run the following command to ensure BLAST is installed correctly:

   blastn -version
   

Step 2: Prepare a Local Database

To run BLAST offline, you’ll need a sequence database.

1. Download a Pre-Built Database (Optional):

   • NCBI provides ready-to-use databases such as nt, nr, and Swiss-Prot. Use the update_blastdb.pl script (bundled with BLAST) to download these:

     update_blastdb.pl --decompress nt
     

2. Create a Custom Database:
   If you have specific sequences to use as a database:

   • Prepare a FASTA file containing the sequences.
   • Use makeblastdb to create a database:

     makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
     

     Replace [nucl|prot] with nucl for nucleotide sequences or prot for protein sequences.

Step 3: Prepare the Query Sequence

• Save your query sequence(s) in FASTA format.
• Ensure the file is properly formatted, with a header line starting with > followed by the sequence name, and the sequence on subsequent lines.

Example:

>query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA

Step 4: Run BLAST

1. Choose the Appropriate BLAST Tool:
   Depending on your data type:

   • blastn: For nucleotide-nucleotide searches.
   • blastp: For protein-protein searches.
   • blastx: Translates nucleotide sequences into proteins and compares them to a protein database.
   • tblastn: Compares protein sequences to a nucleotide database.
   • tblastx: Translates both nucleotide query and database sequences.

2. Run the Command:
   Example command for blastn:

   blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
   

   Explanation of Parameters:

   • -query: Specifies the query file.
   • -db: Points to the local database.
   • -out: Output file name.
   • -outfmt: Output format (e.g., 6 for tabular format).
   • -evalue: E-value cutoff for significance.

Step 5: Interpret Results

1. Output Formats:

   • Default (outfmt 0): Human-readable format.
   • Tabular (outfmt 6): Includes fields like query ID, subject ID, percent identity, alignment length, etc.

2. Analyze Results:
   Use tools like grep, Python, or R to parse and filter results for downstream analysis.

Step 6: Optimize Performance

For large datasets, BLAST can be resource-intensive. To improve performance:

1. Multithreading:
   Use the -num_threads option to leverage multiple CPU cores:

   blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
   

2. Database Subsetting:
   Split large databases into smaller chunks for faster searches.

3. Adjust Parameters:

   • Lower the -evalue threshold for stricter matches.
   • Use -max_target_seqs to limit the number of results per query.

Step 7: Update Databases (Optional)

If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:

update_blastdb.pl --decompress nt

Conclusion

Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.

For advanced use cases, explore BLAST’s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!

I'm running "OPERA-LG_v2.0.5/bin/preprocess_reads.pl" and have the following error:

fail to open file './temporarySam'

[bwa_aln_core] write to the disk... 0.09 sec
[bwa_aln_core] 70778880 sequences have been processed.
[bwa_aln_core] calculate SA coordinate... 161.35 sec
[bwa_aln_core] write to the disk... 0.06 sec
[bwa_aln_core] 70989574 sequences have been processed.
[main] Version: 0.7.15-r1140
[main] CMD: bwa aln -t 30 all_p_ctg.fa -
[main] Real time: 2402.523 sec; CPU: 53429.488 sec
[E::hts_open_format] Failed to open file temporarySam
samtools sort: can't open "temporarySam": No such file or directory
[bwa_aln_core] convert to sequence coordinate... 1.00 sec
[bwa_aln_core] refine gapped alignments... 6.07 sec
[bwa_aln_core] print alignments... PREPROCESS:
Fastq format is recognized
[Thu Jun 14 18:16:47 2018] Building bwa index...
bwa index -p all_p_ctg.fa /home/urbe/Tools/OPERA-LG_v2.0.6/all_p_ctg.fa
[Thu Jun 14 18:18:35 2018] Finding the SA coordinates of the reads using BWA aln...
[Thu Jun 14 18:58:37 2018] Generate alignments of reads using bwa sampe...
bwa samse -n 1 all_p_ctg.fa read.sai - | grep '\(^@\|XT:A:U\)' | /usr/local/bin/samtools view -S -h -b -F 0x4 - | /usr/local/bin/samtools sort -@ 20 -no - temporarySam > FALCON-Unzip-Scaff.bam
Mapping long-reads using blasr...
/home/urbe/Tools/SSpace/SSPACE-LongRead_v1-1/blasr -nproc 40 -m 1 -minMatch 5 -bestn 10 -noSplitSubreads -advanceExactMatches 1 -nCandidates 1 -maxAnchorsPerPosition 1 -sdpTupleSize 7 /media/urbe/MyDDrive/ONTdata/allONT/allONT.fasta /home/urbe/Tools/OPERA-LG_v2.0.6/all_p_ctg.fa | cut -d ' ' -f1-5,7-12 | sed 's/ /\t/g' > FALCON-Unzip-Scaff.map
sh: 1: /home/urbe/Tools/SSpace/SSPACE-LongRead_v1-1/blasr: Permission denied
Sorting mapping results...
sort -k1,1 -k9,9g FALCON-Unzip-Scaff.map > FALCON-Unzip-Scaff.map.sort
Analyzing sorted results...
Extracting linking information...
i3 2000 5000
i2 1000 2000
i4 5000 15000
i0 -200 300
i5 15000 40000
i1 300 1000
Repeat detection...
/home/urbe/Tools/OPERA-LG_v2.0.6/bin//filter_conflicting_edge.pl pairedEdges_i0 contig_length.dat 100 2
Illegal division by zero at /home/urbe/Tools/OPERA-LG_v2.0.6/bin//filter_conflicting_edge.pl line 93.
readline() on closed filehandle FILE at bin/OPERA-long-read.pl line 250.
rm anchor_contig_info.dat contig_length.dat filtered_edges.dat filtered_edges_cov.dat *.sai
rm: cannot remove 'anchor_contig_info.dat': No such file or directory
mv FALCON-Unzip-Scaff.bam FALCON-Unzip-Scaff-with-repeat.bam
/home/urbe/Tools/OPERA-LG_v2.0.6/bin//filter_repeat.pl FALCON-Unzip-Scaff-with-repeat.bam repeat.dat | /usr/local/bin/samtools view - -h -S -b > FALCON-Unzip-Scaff.bam
rm FALCON-Unzip-Scaff-with-repeat.bam
/home/urbe/Tools/OPERA-LG_v2.0.6/bin/OPERA-LG config > log
Analyzing 1 library: FALCON-Unzip-Scaff.bam
min library mean : 0
minimum contig length is 500
Current library: 1 out of 7
Analyzing file: pairedEdges_no_repeat_i0
Analyzing file: pairedEdges_no_repeat_i1
Analyzing file: pairedEdges_no_repeat_i2
Analyzing file: pairedEdges_no_repeat_i3
Analyzing file: pairedEdges_no_repeat_i4
Analyzing file: pairedEdges_no_repeat_i5
ln -s results/scaffoldSeq.fasta scaffoldSeq.fasta

To resolve this, try downloading blasr version 1.3 above and re-run :)

Address of the bookmark: https://github.com/elswob/SCUBAT

Address of the bookmark: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC430967/

This seventh Make Our Planet Great Again (MOPGA) call for applications is intended to welcome at least 40 early career researchers wishing to carry out their research in France. The program is funded by the French Ministry for Europe and Foreign Affairs, in collaboration with the French Ministry for Higher Education and Research, and implemented by Campus France.

The MOPGA 2024 Visiting Fellowship Program for Early Career Researchers will support researchers working on topics listed in the "Research Themes" section.

More at https://www.campusfrance.org/en/mopga-2024

Address of the bookmark: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1352388/

I made Rebaler for bacterial genomes (specifically for the task of testing basecallers). It should in principle work for non-bacterial genomes as well, but I haven't tested it.

Address of the bookmark: https://github.com/rrwick/Rebaler

clean: the transcript origin is from the focal sample.

cross contamination: the transcript origin is from an alien sample of the same experiment.

dubious: expression levels are too close between focal and alien samples to determine the true origin of the transcript.

low coverage: expression levels are too low in all samples, thus hampering our procedure (which relies on differential expression) to confidently assign it to any category.

over expressed: expression levels are very high in at least 3 samples and CroCo will not try to categorize it. Indeed, such a pattern does not correspond to expectations for cross contaminations, but often reflect highly conserved genes such as ribosomal gene, or external contamination shared by several samples (e.g. Escherichia coli contaminations).

Address of the bookmark: https://gitlab.mbb.univ-montp2.fr/mbb/CroCo