<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/36895?offset=70</link>
	<atom:link href="https://bioinformaticsonline.com/related/36895?offset=70" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40940/consed-a-finishing-package-bam-file-viewer-assembly-editor-autofinish-autoreport-autoedit-and-align-reads-to-reference-sequence</guid>
	<pubDate>Fri, 07 Feb 2020 07:16:22 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40940/consed-a-finishing-package-bam-file-viewer-assembly-editor-autofinish-autoreport-autoedit-and-align-reads-to-reference-sequence</link>
	<title><![CDATA[Consed--A Finishing Package (BAM File Viewer, Assembly Editor, Autofinish, Autoreport, Autoedit, and Align Reads To Reference Sequence)]]></title>
	<description><![CDATA[<ul>
<li>Supports Illumina, 454, other Next-Gen and Sanger Reads and allows mixtures of these read types</li>
<li>Consed includes BamScape which can view bam files with unlimited numbers of reads. BamScape can bring up consed to edit reads and the reference sequence in targeted regions.</li>
<li>Consed is compatible with Newbler, Cross_match, Phrap, MIRA, Velvet and PCAP output.</li>
<li>Quickly takes the user to each variant site for viewing (also available as an automated report)</li>
<li>Overview of assembly can help detect and fix misassemblies</li>
<li>Editing time reduced by the program's ability to pin-point problem areas</li>
<li>Editing is guided by error probabilities</li>
</ul><p>Address of the bookmark: <a href="http://www.phrap.org/consed/consed.html" rel="nofollow">http://www.phrap.org/consed/consed.html</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44593/bear-better-emulation-for-artificial-reads</guid>
	<pubDate>Sat, 06 Jul 2024 04:27:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44593/bear-better-emulation-for-artificial-reads</link>
	<title><![CDATA[BEAR: Better Emulation for Artificial Reads]]></title>
	<description><![CDATA[<p dir="auto">Created by Stephen Johnson, Brett Trost, Dr. Jeffrey R. Long, Dr. Anthony Kusalik University of Saskatchewan, Department of Computer Science</p>
<p dir="auto">BEAR is intended to be an easy-to-use collection of scripts for generating simulated WGS metagenomic reads with read lengths, quality scores, error profiles, and species abundances derived from real user-supplied WGS data.</p><p>Address of the bookmark: <a href="https://github.com/sej917/BEAR" rel="nofollow">https://github.com/sej917/BEAR</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/view/982</guid>
	<pubDate>Wed, 17 Jul 2013 15:25:09 -0500</pubDate>
	<link>https://bioinformaticsonline.com/view/982</link>
	<title><![CDATA[Is reference genome necessary for gene expression study in transcriptome sequencing or for variant discovery in genome sequencing?]]></title>
	<description><![CDATA[<p><span>Like in case of plant genomes where nature of genome is too complex and huge in size to accomplish complete<em> de novo</em> assembly by current sequencing technology. What would be alternate solution? Can we live in reference free world?</span></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/view/2044</guid>
	<pubDate>Mon, 12 Aug 2013 12:19:29 -0500</pubDate>
	<link>https://bioinformaticsonline.com/view/2044</link>
	<title><![CDATA[Does anyone have Nanopore latest updates?]]></title>
	<description><![CDATA[<p>There was a lot of buzz about&nbsp;<span>Oxford Nanopore Technologies&reg; is developing the GridION&trade; system and miniaturised MinION&trade; device. These are a new generation of electronic molecular analysis system for use in scientific research, personalised medicine, crop science, security/defence and more. The platform technology uses nanopores to analyse single molecules including DNA/RNA and proteins. With a broad patent portfolio, the Oxford Nanopore pipeline includes biological nanopores and solid-state nanopores.</span></p><p>Is this available, or still under trial mode?&nbsp;</p><p><a href="https://www.nanoporetech.com/">https://www.nanoporetech.com/</a></p><p><a href="https://www.nanoporetech.com/technology/the-minion-device-a-miniaturised-sensing-system/the-minion-device-a-miniaturised-sensing-system">https://www.nanoporetech.com/technology/the-minion-device-a-miniaturised-sensing-system/the-minion-device-a-miniaturised-sensing-system</a></p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/4183/320000-viruses-in-mammals-yet-to-sequenced-in-future</guid>
	<pubDate>Tue, 03 Sep 2013 08:35:30 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/4183/320000-viruses-in-mammals-yet-to-sequenced-in-future</link>
	<title><![CDATA[320000 viruses in mammals yet to sequenced in future!!!]]></title>
	<description><![CDATA[<p>With current biological technique improvements, finally it is now possible to look at millions of unknown viruses at genomic level and understand the mechanism. According to available data, close to 70 per cent of emerging viral diseases such as HIV/AIDS, West Nile, Ebola, SARS, and influenza, are zoonoses - infections of animals that cross into humans.</p><p>To address the challenges of describing and estimating virodiversity, a team of investigators from Center for Infection and Immunity (CII) and EcoHealth Alliance began in jungles of Bangladesh - home to the flying fox.</p><p>Reference:</p><p><a href="http://economictimes.indiatimes.com/news/news-by-industry/et-cetera/mammals-harbour-at-least-320000-new-viruses/articleshow/22253268.cms">http://economictimes.indiatimes.com/news/news-by-industry/et-cetera/mammals-harbour-at-least-320000-new-viruses/articleshow/22253268.cms</a></p><p><a href="http://www.bbc.co.uk/news/science-environment-23932400">http://www.bbc.co.uk/news/science-environment-23932400</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/6130/rna-bioinformatics-and-high-throughput-analysis-jena</guid>
  <pubDate>Sat, 09 Nov 2013 20:03:56 -0600</pubDate>
  <link></link>
  <title><![CDATA[RNA Bioinformatics and High Throughput Analysis Jena]]></title>
  <description><![CDATA[
<p>Research Topics:</p>

<p>High Throughput Sequencing Analysis<br />Comparative Genomics<br />Identification and Annotation of Non-coding RNAs<br />Bioinformatic Analysis and System Biology of Viruses<br />Coevolution of Proteins and RNAs<br />Algorithmic Bioinformatics<br />Phylogenetic Analysis</p>

<p>http://www.rna.uni-jena.de/index.php</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/10093/bio-rad-acquires-gnubio</guid>
	<pubDate>Sat, 19 Apr 2014 10:36:36 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/10093/bio-rad-acquires-gnubio</link>
	<title><![CDATA[Bio-Rad Acquires GnuBIO]]></title>
	<description><![CDATA[<p>http://www.businesswire.com/news/home/20140411005331/en/Bio-Rad-Acquires-GnuBIO-Developer-Droplet-Based-DNA-Sequencing#.U1KXnPm1b8o</p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/10246/deadly-human-pathogen-cryptococcus-sequenced</guid>
	<pubDate>Fri, 25 Apr 2014 11:02:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/10246/deadly-human-pathogen-cryptococcus-sequenced</link>
	<title><![CDATA[Deadly Human Pathogen Cryptococcus  Sequenced]]></title>
	<description><![CDATA[<p><span>"Now, researchers have sequenced the entire genome and all the RNA products of the most important pathogenic lineage of Cryptococcus neoformans, a strain called H99. The results, which appear in&nbsp;</span><em>PLOS Genetics</em><span>, also describe a number of genetic changes that can occur after laboratory handling of H99 that make it more susceptible to stress, hamper its ability to sexually reproduce and render it less virulent."</span></p><p><span><strong>Source</strong>:</span></p><p><span>http://www.biosciencetechnology.com/news/2014/04/deadly-human-pathogen-cryptococcus-fully-sequenced</span></p><p><span><strong>Paper</strong>:</span></p><p><span>http://www.plosgenetics.org/article/info%3Adoi%2F10.1371%2Fjournal.pgen.1004292</span></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/11249/how-to-sequence-the-human-genome-mark-j-kiel</guid>
	<pubDate>Fri, 30 May 2014 13:24:11 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/11249/how-to-sequence-the-human-genome-mark-j-kiel</link>
	<title><![CDATA[How to sequence the human genome - Mark J. Kiel]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/MvuYATh7Y74" frameborder="0" allowfullscreen></iframe>View full lesson: http://ed.ted.com/lessons/how-to-sequence-the-human-genome-mark-j-kiel

Your genome, every human's genome, consists of a unique DNA sequence of A's, T's, C's and G's that tell your cells how to operate. Thanks to technological advances, scientists are now able to know the sequence of letters that makes up an individual genome relatively quickly and inexpensively. Mark J. Kiel takes an in-depth look at the science behind the sequence.

Lesson by Mark J. Kiel, animation by Marc Christoforidis.]]></description>
	
</item>

</channel>
</rss>