<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/36897?offset=480</link>
	<atom:link href="https://bioinformaticsonline.com/related/36897?offset=480" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34567/jobtree-based-python-wrapper-to-run-the-genome-simulation-tool-suite-evolver</guid>
	<pubDate>Fri, 08 Dec 2017 16:26:32 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34567/jobtree-based-python-wrapper-to-run-the-genome-simulation-tool-suite-evolver</link>
	<title><![CDATA[jobTree based python wrapper to run the genome simulation tool suite Evolver]]></title>
	<description><![CDATA[<p><span>evolverSimControl</span><span>&nbsp;(</span><span>eSC</span><span>) can be used to simulate multi-chromosome genome evolution on an arbitrary phylogeny (</span><a href="http://evolution.genetics.washington.edu/phylip/newicktree.html">Newick format</a><span>). In addition to simply running evolver,&nbsp;</span><span>eSC</span><span>&nbsp;also automatically creates statistical summaries of the simulation as it runs including text and image files. Also included are convenience scripts to: check on a running simulation and see detailed status and logging information; extract fasta sequence files from the leaf nodes of a completed simulation; extract pairwise multiple alignment files (</span><a href="http://genome.ucsc.edu/FAQ/FAQformat.html#format5">.maf</a><span>) from leaf and branch nodes from a completed simulation and with the help of&nbsp;</span><a href="https://github.com/dentearl/mafTools/">mafJoin</a><span>, join them together into a single maf covering the entire simulation.</span></p><p>Address of the bookmark: <a href="https://github.com/dentearl/evolverSimControl" rel="nofollow">https://github.com/dentearl/evolverSimControl</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34620/mash-fast-genome-and-metagenome-distance-estimation-using-minhash</guid>
	<pubDate>Tue, 12 Dec 2017 17:30:12 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34620/mash-fast-genome-and-metagenome-distance-estimation-using-minhash</link>
	<title><![CDATA[Mash: fast genome and metagenome distance estimation using MinHash]]></title>
	<description><![CDATA[<p>Mash is normally distributed as a dependency-free binary for Linux or OSX (see&nbsp;<a href="https://github.com/marbl/Mash/releases">https://github.com/marbl/Mash/releases</a>). This source distribution is intended for other operating systems or for development. Mash requires c++11 to build, which is available in and GCC &gt;= 4.8 and OSX &gt;= 10.7.</p>
<p>See&nbsp;<a href="http://mash.readthedocs.org/">http://mash.readthedocs.org</a>&nbsp;for more information.</p><p>Address of the bookmark: <a href="https://github.com/marbl/Mash/releases" rel="nofollow">https://github.com/marbl/Mash/releases</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35135/alitv%E2%80%94interactive-visualization-of-whole-genome-comparisons</guid>
	<pubDate>Wed, 10 Jan 2018 07:08:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35135/alitv%E2%80%94interactive-visualization-of-whole-genome-comparisons</link>
	<title><![CDATA[AliTV—interactive visualization of whole genome comparisons]]></title>
	<description><![CDATA[<p>AliTV, which provides interactive visualization of whole genome alignments. AliTV reads multiple whole genome alignments or automatically generates alignments from the provided data. Optional feature annotations and phylo- genetic information are supported. The user-friendly, web-browser based and highly customizable interface allows rapid exploration and manipulation of the visualized data as well as the export of publication-ready high-quality figures. AliTV is freely available at&nbsp;<a href="https://github.com/AliTVTeam/AliTV">https://github.com/AliTVTeam/AliTV</a></p>
<p>https://alitvteam.github.io/AliTV/</p><p>Address of the bookmark: <a href="https://github.com/AliTVTeam/AliTV" rel="nofollow">https://github.com/AliTVTeam/AliTV</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41158/carefully-opt-for-human-reference-genome</guid>
	<pubDate>Tue, 18 Feb 2020 07:43:32 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41158/carefully-opt-for-human-reference-genome</link>
	<title><![CDATA[Carefully opt for human reference genome]]></title>
	<description><![CDATA[<p><a href="http://lh3.github.io/2017/11/13/which-human-reference-genome-to-use" target="_blank">Heng Li posted several issues with the human reference genomes given in these resources</a> and suggests the following compressed FASTA file to be used as hg38/GRCh38 human reference genome.</p>
<p>if you map reads to GRCh38 or hg38, use the following:</p>
<div>
<div>
<pre><code>ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/405/GCA_000001405.15_GRCh38/seqs_for_alignment_pipelines.ucsc_ids/GCA_000001405.15_GRCh38_no_alt_analysis_set.fna.gz
</code></pre>
</div>
</div>
<p>There are several other versions of GRCh37/GRCh38. What&rsquo;s wrong with them? Here are a collection of potential issues:</p>
<p>More at http://lh3.github.io/2017/11/13/which-human-reference-genome-to-use</p><p>Address of the bookmark: <a href="http://lh3.github.io/2017/11/13/which-human-reference-genome-to-use" rel="nofollow">http://lh3.github.io/2017/11/13/which-human-reference-genome-to-use</a></p>]]></description>
	<dc:creator>biogeek</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36918/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</guid>
	<pubDate>Tue, 12 Jun 2018 08:14:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36918/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</link>
	<title><![CDATA[P_RNA_scaffolder: a fast and accurate genome scaffolder using paired-end RNA-sequencing reads]]></title>
	<description><![CDATA[P_RNA_scaffolder, a fast and accurate tool using paired-end RNA-sequencing reads to scaffold genomes. This tool aims to improve the completeness of both protein-coding and non-coding genes. After this tool was applied to scaffolding human contigs, the structures of both protein-coding genes and circular RNAs were almost completely recovered and equivalent to those in a complete genome, especially for long proteins and long circular RNAs.<p>Address of the bookmark: <a href="http://www.fishbrowser.org/software/P_RNA_scaffolder/" rel="nofollow">http://www.fishbrowser.org/software/P_RNA_scaffolder/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37650/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</guid>
	<pubDate>Fri, 07 Sep 2018 05:19:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37650/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</link>
	<title><![CDATA[P_RNA_scaffolder: a fast and accurate genome scaffolder using paired-end RNA-sequencing reads]]></title>
	<description><![CDATA[<p><span>P_RNA_scaffolder is a novel scaffolding tool using Pair-end RNA-seq to scaffold genome fragments. The method is suitable for most genomes. The program could utilize Illumina Paired-end RNA-sequencing reads from target speciesies. Our method provides another practical alternative to existing mate-pair_based approaches or other Protein-based approaches (for instance,&nbsp;</span><a href="http://www.fishbrowser.org/software/PEP_scaffolder/">PEP_scaffolder&nbsp;</a><span>) for scaffolding genome sequences. The most important feature of this method is to improve the completeness of gene regions and long-coding gene regions (for instance,&nbsp;</span><a href="http://circrna.org/">circRNA</a><span>).</span></p><p>Address of the bookmark: <a href="http://www.fishbrowser.org/software/P_RNA_scaffolder/#" rel="nofollow">http://www.fishbrowser.org/software/P_RNA_scaffolder/#</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38053/swgis-v20-a-seqword-genomic-island-sniffer</guid>
	<pubDate>Thu, 01 Nov 2018 12:35:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38053/swgis-v20-a-seqword-genomic-island-sniffer</link>
	<title><![CDATA[swgis v2.0 : a seqword genomic island sniffer]]></title>
	<description><![CDATA[<p><strong>swgis v2.0</strong>&nbsp;is the modified version of the seqword genomic island sniffer. this version is specifically optimized for predicting genomic islands in eukaryotic genomes. swgis v2.0 was tested on several eukaryotic species of different lineages. all identified genomic islands were deposited in the&nbsp;<a href="http://eugi.bi.up.ac.za/" title="Go to EuGI database">eugi database</a>.</p>
<p><a href="http://eugi.bi.up.ac.za/download_swgis/swgisv2.0.zip" title="Download SWGIS v2.0">download swgis v2.0</a></p><p>Address of the bookmark: <a href="http://eugi.bi.up.ac.za/eugi_download_swgis.php" rel="nofollow">http://eugi.bi.up.ac.za/eugi_download_swgis.php</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38443/genoplotr-plot-gene-and-genome-maps-project</guid>
	<pubDate>Wed, 12 Dec 2018 08:33:41 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38443/genoplotr-plot-gene-and-genome-maps-project</link>
	<title><![CDATA[genoPlotR - plot gene and genome maps project!]]></title>
	<description><![CDATA[<p>genoPlotR is a R package to produce reproducible, publication-grade graphics of gene and genome maps. It allows the user to read from usual format such as protein table files and blast results, as well as home-made tabular files.</p>
<h3>Features</h3>
<ul>
<li>Linear representation of several segments of DNA</li>
<li>Comparisons represented by areas between the segments (like Artemis, for example)</li>
<li>Reads from common formats: Genbank, EMBL, blast, Mauve, and from user-generated tab files</li>
<li>Plot several subsegments of the same segment on the same line, separated by a //</li>
<li>Automatic or manual placement of the segments on the plot</li>
<li>Add annotations to all the lines</li>
<li>Create smart, automatic annotations for genomes, based on gene names</li>
<li>Add a user-generated tree</li>
<li>Add a global scale or a scale to each line</li>
<li>Use user-defined graphical functions to represent genes</li>
<li></li>
</ul><p>Address of the bookmark: <a href="http://genoplotr.r-forge.r-project.org/" rel="nofollow">http://genoplotr.r-forge.r-project.org/</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39236/causel-an-epigenome-and-genome-editing-pipeline-for-establishing-function-of-noncoding-gwas-variants</guid>
	<pubDate>Tue, 09 Apr 2019 07:23:37 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39236/causel-an-epigenome-and-genome-editing-pipeline-for-establishing-function-of-noncoding-gwas-variants</link>
	<title><![CDATA[CAUSEL: an epigenome- and genome-editing pipeline for establishing function of noncoding GWAS variants]]></title>
	<description><![CDATA[<p><span>Validated a widely accessible approach that can be used to establish functional causality for noncoding sequence variants identified by GWASs.</span></p>
<p><a href="https://www.nature.com/articles/nm.3975">https://www.nature.com/articles/nm.3975</a></p><p>Address of the bookmark: <a href="https://www.nature.com/articles/nm.3975" rel="nofollow">https://www.nature.com/articles/nm.3975</a></p>]]></description>
	<dc:creator>BioJoker</dc:creator>
</item>

</channel>
</rss>