<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/36918?offset=50</link>
	<atom:link href="https://bioinformaticsonline.com/related/36918?offset=50" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40889/rcorrector-efficient-and-accurate-error-correction-for-illumina-rna-seq-reads</guid>
	<pubDate>Tue, 04 Feb 2020 23:23:16 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40889/rcorrector-efficient-and-accurate-error-correction-for-illumina-rna-seq-reads</link>
	<title><![CDATA[Rcorrector: efficient and accurate error correction for Illumina RNA-seq reads]]></title>
	<description><![CDATA[<p><span>Rcorrector has an accuracy higher than or comparable to existing methods, including the only other method (SEECER) designed for RNA-seq reads, and is more time and memory efficient. With a 5 GB memory footprint for 100 million reads, it can be run on virtually any desktop or server. The software is available free of charge under the GNU General Public License from&nbsp;</span><a href="https://github.com/mourisl/Rcorrector/" target="_blank">https://github.com/mourisl/Rcorrector/</a><span>.</span></p>
<pre><code>Usage: perl run_rcorrector.pl [OPTIONS]
OPTIONS:
	Required
	-s seq_files: comma separated files for single-end data sets
	-1 seq_files_left: comma separated files for the first mate in the paried-end data sets
	-2 seq_files_right: comma separated files for the second mate in the paired-end data sets
	-i seq_files_interleaved: comma sperated files for interleaved paired-end data sets
	Optional
	-k INT: kmer_length (&lt;=32, default: 23)
	-od STRING: output_file_directory (default: ./)
	-t INT: number of threads to use (default: 1)
	-trim : allow trimming (default: false)
	-maxcorK INT: the maximum number of correction within k-bp window (default: 4)
	-wk FLOAT: the proportion of kmers that are used to estimate weak kmer count threshold, lower for more divergent genome (default: 0.95)
	-ek INT: expected number of kmers; does not affect the correctness of program but affects the memory usage (default: 100000000)
	-stdout: output the corrected reads to stdout (default: not used)
	-verbose: output some correction information to stdout (default: not used)
	-stage INT: start from which stage (default: 0)
		0-start from begining(storing kmers in bloom filter) ;
		1-start from count kmers showed up in bloom filter;
		2-start from dumping kmer counts into a jf_dump file;
		3-start from error correction.</code></pre><p>Address of the bookmark: <a href="https://github.com/mourisl/Rcorrector/" rel="nofollow">https://github.com/mourisl/Rcorrector/</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44902/hite-a-fast-and-accurate-dynamic-boundary-adjustment-approach-for-full-length-transposable-elements-detection-and-annotation-in-genome-assemblies</guid>
	<pubDate>Sat, 20 Sep 2025 09:34:04 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44902/hite-a-fast-and-accurate-dynamic-boundary-adjustment-approach-for-full-length-transposable-elements-detection-and-annotation-in-genome-assemblies</link>
	<title><![CDATA[HiTE: a fast and accurate dynamic boundary adjustment approach for full-length Transposable Elements detection and annotation in Genome Assemblies]]></title>
	<description><![CDATA[<p dir="auto"><code>HiTE</code>&nbsp;is a Python software that uses a dynamic boundary adjustment approach to detect and annotate full-length Transposable Elements in Genome Assemblies. In comparison to other tools, HiTE demonstrates superior performance in detecting a greater number of full-length TEs.</p>
<div dir="auto">
<h2 dir="auto">panHiTE</h2>
<a href="https://github.com/CSU-KangHu/HiTE#panhite"></a></div>
<p dir="auto">We have developed panHiTE, a comprehensive and accurate pipeline for TE detection in large-scale population genomes. It has been successfully applied to hundreds of plant population genomes, demonstrating its effectiveness and scalability.</p>
<p dir="auto">For detailed instructions, please refer to the&nbsp;<a href="https://github.com/CSU-KangHu/HiTE/wiki/panHiTE-tutorial">panHiTE tutorial</a>.</p><p>Address of the bookmark: <a href="https://github.com/CSU-KangHu/HiTE" rel="nofollow">https://github.com/CSU-KangHu/HiTE</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42415/sneakysnake-a-fast-and-accurate-universal-genome-pre-alignment-filter-for-cpus-gpus-and-fpgas</guid>
	<pubDate>Sun, 20 Dec 2020 01:39:54 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42415/sneakysnake-a-fast-and-accurate-universal-genome-pre-alignment-filter-for-cpus-gpus-and-fpgas</link>
	<title><![CDATA[SneakySnake: A Fast and Accurate Universal Genome Pre-Alignment Filter for CPUs, GPUs, and FPGAs]]></title>
	<description><![CDATA[<p><span>The first and the only pre-alignment filtering algorithm that works efficiently and fast on modern CPU, FPGA, and GPU architectures. SneakySnake greatly (by more than two orders of magnitude) expedites sequence alignment calculation for both short (Illumina) and long (ONT and PacBio) reads. Described by Alser et al. (preliminary version at&nbsp;</span><a href="https://arxiv.org/abs/1910.09020">https://arxiv.org/abs/1910.09020</a><span>).</span></p><p>Address of the bookmark: <a href="https://github.com/CMU-SAFARI/SneakySnake" rel="nofollow">https://github.com/CMU-SAFARI/SneakySnake</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36635/circlator-automated-circularization-of-genome-assemblies-using-long-sequencing-reads</guid>
	<pubDate>Tue, 15 May 2018 09:42:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36635/circlator-automated-circularization-of-genome-assemblies-using-long-sequencing-reads</link>
	<title><![CDATA[Circlator: automated circularization of genome assemblies using long sequencing reads]]></title>
	<description><![CDATA[A tool to circularize genome assemblies. The algorithm and benchmarks are described in the Genome Biology manuscript. 

Citation: "Circlator: automated circularization of genome assemblies using long sequencing reads", Hunt et al, Genome Biology 2015 Dec 29;16(1):294. doi: 10.1186/s13059-015-0849-0. PMID: 26714481.<p>Address of the bookmark: <a href="http://sanger-pathogens.github.io/circlator/" rel="nofollow">http://sanger-pathogens.github.io/circlator/</a></p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37306/genome-u-plot-a-whole-genome-visualization</guid>
	<pubDate>Fri, 13 Jul 2018 19:50:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37306/genome-u-plot-a-whole-genome-visualization</link>
	<title><![CDATA[Genome U-Plot: a whole genome visualization]]></title>
	<description><![CDATA[<p><span>Genome U-Plot for producing clear and intuitive graphs that allows researchers to generate novel insights and hypotheses by visualizing SVs such as deletions, amplifications, and chromoanagenesis events. The main features of the Genome U-Plot are its layered layout, its high spatial resolution and its improved aesthetic qualities.&nbsp;</span></p>
<p><span>https://github.com/gaitat/GenomeUPlot</span></p><p>Address of the bookmark: <a href="https://github.com/gaitat/GenomeUPlot" rel="nofollow">https://github.com/gaitat/GenomeUPlot</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37840/long-read-assembly-workshop</guid>
	<pubDate>Thu, 04 Oct 2018 17:23:18 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37840/long-read-assembly-workshop</link>
	<title><![CDATA[Long read assembly workshop !]]></title>
	<description><![CDATA[<p>This is a tutorial for a workshop on long-read (PacBio) genome assembly.</p>
<p>It demonstrates how to use long PacBio sequencing reads to assemble a bacterial genome, and includes additional steps for circularising, trimming, finding plasmids, and correcting the assembly with short-read Illumina data.</p>
<p>&nbsp;Please comment if you know any other long read addembly tutorial.</p><p>Address of the bookmark: <a href="http://sepsis-omics.github.io/tutorials/modules/cmdline_assembly_v2/" rel="nofollow">http://sepsis-omics.github.io/tutorials/modules/cmdline_assembly_v2/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39624/cogent-a-tool-for-reconstructing-the-coding-genome-using-high-quality-full-length-transcriptome-sequences</guid>
	<pubDate>Tue, 18 Jun 2019 05:33:04 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39624/cogent-a-tool-for-reconstructing-the-coding-genome-using-high-quality-full-length-transcriptome-sequences</link>
	<title><![CDATA[Cogent: a tool for reconstructing the coding genome using high-quality full-length transcriptome sequences.]]></title>
	<description><![CDATA[<div id="yui_3_14_1_1_1560853173251_3865">Cogent is a tool that identifies gene&nbsp;families and reconstructs the coding genome using high-quality transcriptome data without a reference genome, and can be used to check&nbsp;assemblies&nbsp;for the presence of&nbsp;these known coding sequences.</div>
<div>&nbsp;</div>
<div>
<p>Cogent is a tool for reconstructing the coding genome using high-quality full-length transcriptome sequences. It is designed to be used on&nbsp;<a href="https://github.com/PacificBiosciences/cDNA_primer/wiki">Iso-Seq data</a>&nbsp;and in cases where there is no reference genome or the ref genome is highly incomplete.</p>
<p>See a&nbsp;<a href="https://www.dropbox.com/s/mn6hwhguh0pqceu/20160106_Cogent_developers_conference_slides_Cuttlefish.pdf?dl=0">recent presentation</a>&nbsp;on Cogent being applied to the Cuttlefish Iso-Seq data.</p>
<p><a href="https://www.dropbox.com/s/kz0gi7qg0w82k9a/20161026_Cogent_manuscript_forGitHub.pdf?dl=0">Cogent preliminary draft paper (updated 2016Dec version)</a>,&nbsp;<a href="https://www.dropbox.com/s/37412o8glvnfhf9/20161026_Cogent_ManuscriptPlusSupplement_forGitHub.pdf?dl=0">Supplementary</a></p>
<p>Please see&nbsp;<a href="https://github.com/Magdoll/Cogent/wiki">wiki</a>&nbsp;for details on usage.</p>
</div><p>Address of the bookmark: <a href="https://github.com/Magdoll/Cogent" rel="nofollow">https://github.com/Magdoll/Cogent</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43273/understanding-kmer</guid>
	<pubDate>Wed, 18 Aug 2021 04:27:51 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43273/understanding-kmer</link>
	<title><![CDATA[Understanding kmer !]]></title>
	<description><![CDATA[<p><a href="https://en.wikipedia.org/wiki/k-mer">What is a&nbsp;<em>k-mer</em>&nbsp;anyway?</a><span>&nbsp;A&nbsp;</span><em>k-mer</em><span>&nbsp;is just a sequence of&nbsp;</span><em>k</em><span>&nbsp;characters in a string (or nucleotides in a DNA sequence). Now, it is important to remember that to get&nbsp;</span><em>all k-mers</em><span>&nbsp;from a sequence you need to get the first&nbsp;</span><em>k</em><span>&nbsp;characters, then move just a single character for the start of the next&nbsp;</span><em>k-mer</em><span>&nbsp;and so on. Effectively, this will create sequences that overlap in&nbsp;</span><code>k-1</code><span>&nbsp;positions.</span></p><p>Address of the bookmark: <a href="https://bioinfologics.github.io/post/2018/09/17/k-mer-counting-part-i-introduction/" rel="nofollow">https://bioinfologics.github.io/post/2018/09/17/k-mer-counting-part-i-introduction/</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/43728/short-read-assembly-using-spades</guid>
	<pubDate>Mon, 31 Jan 2022 07:18:16 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/43728/short-read-assembly-using-spades</link>
	<title><![CDATA[Short-read assembly using Spades !]]></title>
	<description><![CDATA[<h2 id="short-read-assembly-a-comparison">If we only had Illumina reads, we could also assemble these using the tool Spades.</h2><p>You can try this here, or try it later on your own data.</p><h2 id="get-data">Get data</h2><p>We will use the same Illumina data as we used above:</p><ul>
<li>illumina_R1.fastq.gz: the Illumina forward reads</li>
<li>illumina_R2.fastq.gz: the Illumina reverse reads</li>
</ul><h2 id="assemble">Assemble</h2><p>Run Spades:</p><div><pre>spades.py -1 illumina_R1.fastq.gz -2 illumina_R2.fastq.gz --careful --cov-cutoff auto -o spades_assembly_all_illumina
</pre></div><ul>
<li><code>-1</code>&nbsp;is input file of forward reads</li>
<li><code>-2</code>&nbsp;is input file of reverse reads</li>
<li><code>--careful</code>&nbsp;minimizes mismatches and short indels</li>
<li><code>--cov-cutoff auto</code>&nbsp;computes the coverage threshold (rather than the default setting, &ldquo;off&rdquo;)</li>
<li><code>-o</code>&nbsp;is the output directory</li>
</ul><h2 id="results">Results</h2><p>Move into the output directory and look at the contigs:</p><div><pre>infoseq contigs.fasta</pre></div>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>

</channel>
</rss>