<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/36945?offset=10</link>
	<atom:link href="https://bioinformaticsonline.com/related/36945?offset=10" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43374/reference-sequence-resource</guid>
	<pubDate>Wed, 15 Sep 2021 21:15:22 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43374/reference-sequence-resource</link>
	<title><![CDATA[Reference Sequence Resource!]]></title>
	<description><![CDATA[<p><span>The ENCODE project uses Reference Genomes from&nbsp;</span><a href="http://www.ncbi.nlm.nih.gov/genome/browse/reference/">NCBI</a><span>&nbsp;or&nbsp;</span><a href="http://hgdownload.cse.ucsc.edu/downloads.html">UCSC</a><span>&nbsp;to provide a consistent framework for mapping high-throughput sequencing data.&nbsp;In general, ENCODE data are mapped consistently to 2 human (GRCH38, hg19) and 2 mouse (mm9/mm10) genomes for historical comparability.&nbsp;</span><em>Drosophia melanogaster</em><span>&nbsp;experiments are mapped to either dm3 or dm6 and&nbsp;</span><em>Caenorhabdilis elegans&nbsp;</em><span>experiments are mapped to ce10 or ce11.&nbsp;T</span></p><p>Address of the bookmark: <a href="https://www.encodeproject.org/data-standards/reference-sequences/" rel="nofollow">https://www.encodeproject.org/data-standards/reference-sequences/</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36918/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</guid>
	<pubDate>Tue, 12 Jun 2018 08:14:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36918/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</link>
	<title><![CDATA[P_RNA_scaffolder: a fast and accurate genome scaffolder using paired-end RNA-sequencing reads]]></title>
	<description><![CDATA[P_RNA_scaffolder, a fast and accurate tool using paired-end RNA-sequencing reads to scaffold genomes. This tool aims to improve the completeness of both protein-coding and non-coding genes. After this tool was applied to scaffolding human contigs, the structures of both protein-coding genes and circular RNAs were almost completely recovered and equivalent to those in a complete genome, especially for long proteins and long circular RNAs.<p>Address of the bookmark: <a href="http://www.fishbrowser.org/software/P_RNA_scaffolder/" rel="nofollow">http://www.fishbrowser.org/software/P_RNA_scaffolder/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37306/genome-u-plot-a-whole-genome-visualization</guid>
	<pubDate>Fri, 13 Jul 2018 19:50:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37306/genome-u-plot-a-whole-genome-visualization</link>
	<title><![CDATA[Genome U-Plot: a whole genome visualization]]></title>
	<description><![CDATA[<p><span>Genome U-Plot for producing clear and intuitive graphs that allows researchers to generate novel insights and hypotheses by visualizing SVs such as deletions, amplifications, and chromoanagenesis events. The main features of the Genome U-Plot are its layered layout, its high spatial resolution and its improved aesthetic qualities.&nbsp;</span></p>
<p><span>https://github.com/gaitat/GenomeUPlot</span></p><p>Address of the bookmark: <a href="https://github.com/gaitat/GenomeUPlot" rel="nofollow">https://github.com/gaitat/GenomeUPlot</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37796/grsr-a-tool-for-deriving-genome-rearrangement-scenarios-from-multiple-unichromosomal-genome-sequences</guid>
	<pubDate>Fri, 28 Sep 2018 09:35:10 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37796/grsr-a-tool-for-deriving-genome-rearrangement-scenarios-from-multiple-unichromosomal-genome-sequences</link>
	<title><![CDATA[GRSR: a tool for deriving genome rearrangement scenarios from multiple unichromosomal genome sequences]]></title>
	<description><![CDATA[<p>GRSR is a Tool for Deriving Genome Rearrangement Scenarios for Multiple Uni-chromosomal Genomes. This tool will do the following steps:</p>
<ul>
<li>Step 1. Run mugsy to get multiple sequence alignment results.</li>
<li>Step 2 &amp; 3. Extraction of the Coordinates of Core Blocks, Construction of Synteny Blocks and Generating Signed Permutations.</li>
<li>Step 4. Generate pairwise genome rearrangement scenarios and find repeats at the breakpoints of each rearrangement events.</li>
<li></li>
<li></li>
</ul>
<p>https://github.com/DanwangJessica/GRSR</p><p>Address of the bookmark: <a href="https://github.com/DanwangJessica/GRSR" rel="nofollow">https://github.com/DanwangJessica/GRSR</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43736/odgi-optimized-dynamic-genomegraph-implementation</guid>
	<pubDate>Tue, 01 Feb 2022 23:42:21 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43736/odgi-optimized-dynamic-genomegraph-implementation</link>
	<title><![CDATA[odgi: optimized dynamic genome/graph implementation]]></title>
	<description><![CDATA[<p dir="auto"><code>odgi</code>&nbsp;provides an efficient and succinct dynamic DNA sequence graph model, as well as a host of algorithms that allow the use of such graphs in bioinformatic analyses.</p>
<p dir="auto">Careful encoding of graph entities allows&nbsp;<code>odgi</code>&nbsp;to efficiently compute and transform&nbsp;<a href="https://pangenome.github.io/">pangenomes</a>&nbsp;with minimal overheads.&nbsp;<code>odgi</code>&nbsp;implements a dynamic data structure that leveraged multi-core CPUs and can be updated on the fly.</p>
<p dir="auto">The edges and path steps are recorded as deltas between the current node id and the target node id, where the node id corresponds to the rank in the global array of nodes. Graphs built from biological data sets tend to have local partial order and, when sorted, the deltas be small. This allows them to be compressed with a variable length integer representation, resulting in a small in-memory footprint at the cost of packing and unpacking.</p>
<p dir="auto">The RAM and computational savings are substantial. In partially ordered regions of the graph, most deltas will require only a single byte.</p><p>Address of the bookmark: <a href="https://github.com/pangenome/odgi" rel="nofollow">https://github.com/pangenome/odgi</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43806/genomicus-genome-browser-that-enables-users-to-navigate-in-genomes-in-several-dimensions</guid>
	<pubDate>Mon, 28 Feb 2022 23:27:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43806/genomicus-genome-browser-that-enables-users-to-navigate-in-genomes-in-several-dimensions</link>
	<title><![CDATA[Genomicus: genome browser that enables users to navigate in genomes in several dimensions]]></title>
	<description><![CDATA[<p>Genomicus is a genome browser that enables users to navigate in genomes in several dimensions: linearly along chromosome axes, transversaly across different species, and chronologicaly along evolutionary time.</p>
<p>Once a query gene has been entered, it is displayed in its genomic context in parallel to the genomic context of all its orthologous and paralogous copies in all the other sequenced metazoan genomes. Moreover, Genomicus stores and displays the predicted ancestral genome structure in all the ancestral species within the phylogenetic range of interest.</p>
<p>All the data on extant species displayed in this browser are from&nbsp;<a href="http://www.ensembl.org/">Ensembl</a>.</p>
<p><br><strong>Summary statistics of Genomicus version 105.01:</strong><span>&nbsp;(view species tree in&nbsp;</span><a href="https://www.genomicus.bio.ens.psl.eu/genomicus-105.01/data/SpeciesTree.pdf">pdf</a><span>&nbsp;or&nbsp;</span><a href="https://www.genomicus.bio.ens.psl.eu/genomicus-105.01/data/SpeciesTree.nwk">newick</a><span>)</span><br><br></p>
<table id="introstats">
<tbody>
<tr><th>Number of extant species</th>
<td>200</td>
</tr>
<tr><th>Number of extant genes</th>
<td>4303993</td>
</tr>
<tr><th>&nbsp;</th></tr>
<tr><th>Number of ancestral species</th>
<td>196</td>
</tr>
<tr><th>Number of ancestral genes</th>
<td>4624213</td>
</tr>
<tr><th>Number of ancestral synteny blocks</th>
<td>83342<br><br></td>
</tr>
</tbody>
</table><p>Address of the bookmark: <a href="https://www.genomicus.bio.ens.psl.eu/genomicus-105.01/cgi-bin/search.pl" rel="nofollow">https://www.genomicus.bio.ens.psl.eu/genomicus-105.01/cgi-bin/search.pl</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36592/lachesis-genome-assembly-with-hi-c-based-contact-probability-maps-lachesis</guid>
	<pubDate>Mon, 14 May 2018 04:26:30 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36592/lachesis-genome-assembly-with-hi-c-based-contact-probability-maps-lachesis</link>
	<title><![CDATA[LACHESIS: Genome Assembly with Hi-C-based Contact Probability Maps (LACHESIS)]]></title>
	<description><![CDATA[<p>LACHESIS is method that exploits contact probability map data (e.g. from Hi-C) for chromosome-scale&nbsp;<em>de novo</em>&nbsp;genome assembly.</p>
<p>Further information about LACHESIS, including source code, documentation and a user's guide are available at:&nbsp;<a href="http://shendurelab.github.io/LACHESIS/">http://shendurelab.github.io/LACHESIS</a>.</p>
<p>Manuscript describing LACHESIS was published as: Burton JN#, Adey A, Patwardhan RP, Qiu R, Kitzman JO, Shendure J#.&nbsp;<em>Chromosome-scale scaffolding of de novo genome assemblies based on chromatin interactions.</em>&nbsp;Nature Biotechnology 2013 Dec;31(12):1119-25. doi:&nbsp;<a href="http://dx.doi.org/10.1038/nbt.2727">10.1038/nbt.272</a>. PubMed PMID:&nbsp;<a href="http://www.ncbi.nlm.nih.gov/pubmed/24185095">24185095</a>.</p>
<p>&nbsp;</p>
<p>http://shendurelab.github.io/LACHESIS/</p><p>Address of the bookmark: <a href="http://shendurelab.github.io/LACHESIS/" rel="nofollow">http://shendurelab.github.io/LACHESIS/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39269/ragoo-fast-reference-guided-scaffolding-of-genome-assembly-contigs</guid>
	<pubDate>Wed, 17 Apr 2019 19:45:22 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39269/ragoo-fast-reference-guided-scaffolding-of-genome-assembly-contigs</link>
	<title><![CDATA[RaGOO: Fast Reference-Guided Scaffolding of Genome Assembly Contigs]]></title>
	<description><![CDATA[<p>Alonge M, Soyk S, Ramakrishnan S, Wang X, Goodwin S, Sedlazeck FJ, Lippman ZB, Schatz MC:&nbsp;<a href="https://www.biorxiv.org/content/early/2019/01/13/519637">Fast and accurate reference-guided scaffolding of draft genomes</a>.&nbsp;<em>bioRxiv</em>&nbsp;2019.</p>
<p>RaGOO is a tool for coalescing genome assembly contigs into pseudochromosomes via minimap2 alignments to a closely related reference genome. The focus of this tool is on practicality and therefore has the following features:</p>
<ol>
<li>Good performance. On a MacBook Pro using Arabidopsis data, pseudochromosome construction takes less than a minute and the whole pipeline with SV calling takes ~2 minutes.</li>
<li>Intact ordering and orienting of contigs.</li>
<li><a href="https://github.com/malonge/RaGOO/wiki/Breaking-Chimeric-Contigs">Chimeric contig correction</a></li>
<li><a href="https://github.com/malonge/RaGOO/wiki/GFF-File-Lift-Over">GFF lift-over</a></li>
<li><a href="https://github.com/malonge/RaGOO/wiki/Calling-Structural-Variants">Structural variant calling with and integrated version of Assemblytics</a></li>
<li>Confidence scores associated with the grouping, localization, and orientation for each contig.</li>
</ol><p>Address of the bookmark: <a href="https://github.com/malonge/RaGOO" rel="nofollow">https://github.com/malonge/RaGOO</a></p>]]></description>
	<dc:creator>BioJoker</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43376/hisat2-index-files-download</guid>
	<pubDate>Wed, 15 Sep 2021 22:17:49 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43376/hisat2-index-files-download</link>
	<title><![CDATA[HISAT2 Index Files Download !]]></title>
	<description><![CDATA[<p>Resource for downloading all the HISAT2 related files&nbsp;</p>
<p>Please cite:</p>
<blockquote>
<p>Kim, D., Paggi, J.M., Park, C.&nbsp;<em>et al.</em>&nbsp;Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype.&nbsp;<em>Nat Biotechnol</em>&nbsp;<strong>37</strong>, 907&ndash;915 (2019).&nbsp;<a href="https://doi.org/10.1038/s41587-019-0201-4" target="_blank">https://doi.org/10.1038/s41587-019-0201-4</a></p>
</blockquote><p>Address of the bookmark: <a href="http://daehwankimlab.github.io/hisat2/download/#h-sapiens" rel="nofollow">http://daehwankimlab.github.io/hisat2/download/#h-sapiens</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>

</channel>
</rss>