<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/36952?offset=0</link>
	<atom:link href="https://bioinformaticsonline.com/related/36952?offset=0" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36954/mscaffolder-a-comparative-genome-scaffolding-tool</guid>
	<pubDate>Fri, 15 Jun 2018 04:48:01 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36954/mscaffolder-a-comparative-genome-scaffolding-tool</link>
	<title><![CDATA[mScaffolder: A comparative genome scaffolding tool]]></title>
	<description><![CDATA[<p>A comparative genome scaffolding tool based on MUMmer</p>
<p>mScaffolder scaffolds a genome using an existing high quality genome as the reference. It aligns the two genomes using nucmer utility from MUMmer and then orders and orients the contigs of the candidate genome guided by their alignments to the reference genome. Please send your questions and comments to&nbsp;<a href="mailto:mchakrab@uci.edu">mchakrab@uci.edu</a>.</p>
<p><span>Citation</span><span>&nbsp;</span><a href="https://www.nature.com/articles/s41588-017-0010-y">https://www.nature.com/articles/s41588-017-0010-y</a></p><p>Address of the bookmark: <a href="https://github.com/mahulchak/mscaffolder" rel="nofollow">https://github.com/mahulchak/mscaffolder</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34475/oxford-nanopore-sequencing-hybrid-error-correction-and-de-novo-assembly-of-a-eukaryotic-genome</guid>
	<pubDate>Wed, 29 Nov 2017 05:08:53 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34475/oxford-nanopore-sequencing-hybrid-error-correction-and-de-novo-assembly-of-a-eukaryotic-genome</link>
	<title><![CDATA[Oxford Nanopore Sequencing, Hybrid Error Correction, and de novo Assembly of a Eukaryotic Genome]]></title>
	<description><![CDATA[<p><span>Monitoring the progress of DNA molecules through a membrane pore has been postulated as a method for sequencing DNA for several decades. Recently, a nanopore-based sequencing instrument, the Oxford Nanopore MinION, has become available that we used for sequencing the S. cerevisiae genome. To make use of these data, we developed a novel open-source hybrid error correction algorithm Nanocorr (</span><a href="https://github.com/jgurtowski/nanocorr">https://github.com/jgurtowski/nanocorr</a><span>) specifically for Oxford Nanopore reads, as existing packages were incapable of assembling the long read lengths (5-50kbp) at such high error rate (between ~5 and 40% error). With this new method we were able to perform a hybrid error correction of the nanopore reads using complementary MiSeq data and produce a de novo assembly that is highly contiguous and accurate: the contig N50 length is more than ten-times greater than an Illumina-only assembly (678kb versus 59.9kbp), and has greater than 99.88% consensus identity when compared to the reference. Furthermore, the assembly with the long nanopore reads presents a much more complete representation of the features of the genome and correctly assembles gene cassettes, rRNAs, transposable elements, and other genomic features that were almost entirely absent in the Illumina-only assembly.</span></p><p>Address of the bookmark: <a href="http://schatzlab.cshl.edu/data/nanocorr/" rel="nofollow">http://schatzlab.cshl.edu/data/nanocorr/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34328/dfast-a-flexible-prokaryotic-genome-annotation-pipeline-for-faster-genome-publication</guid>
	<pubDate>Tue, 14 Nov 2017 10:26:16 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34328/dfast-a-flexible-prokaryotic-genome-annotation-pipeline-for-faster-genome-publication</link>
	<title><![CDATA[DFAST: a flexible prokaryotic genome annotation pipeline for faster genome publication]]></title>
	<description><![CDATA[<p>We developed a prokaryotic genome annotation pipeline, DFAST, that also supports genome submission to public sequence databases. DFAST was originally started as an on-line annotation server, and to date, over 7,000 jobs have been processed since its first launch in 2016. Here, we present a newly implemented background annotation engine for DFAST, which is also available as a standalone command-line program. The new engine can annotate a typical-sized bacterial genome within 10 minutes, with rich information such as pseudogenes, translation exceptions, and orthologous gene assignment between given reference genomes. In addition, the modular framework of DFAST allows users to customize the annotation workflow easily and will also facilitate extensions for new functions and incorporation of new tools in the future.</p>
<div>Availability and Implementation</div>
<p>The software is implemented in Python 3 and runs in both Python 2.7 and 3.4&ndash; on Macintosh and Linux systems. It is freely available at&nbsp;<a href="https://github.com/nigyta/dfast_core/" target="">https://github.com/nigyta/dfast_core/</a>&nbsp;under the GPLv3 license with external binaries bundled in the software distribution. An on-line version is also available at&nbsp;<a href="https://dfast.nig.ac.jp/" target="">https://dfast.nig.ac.jp/</a>.</p><p>Address of the bookmark: <a href="https://dfast.nig.ac.jp/" rel="nofollow">https://dfast.nig.ac.jp/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37306/genome-u-plot-a-whole-genome-visualization</guid>
	<pubDate>Fri, 13 Jul 2018 19:50:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37306/genome-u-plot-a-whole-genome-visualization</link>
	<title><![CDATA[Genome U-Plot: a whole genome visualization]]></title>
	<description><![CDATA[<p><span>Genome U-Plot for producing clear and intuitive graphs that allows researchers to generate novel insights and hypotheses by visualizing SVs such as deletions, amplifications, and chromoanagenesis events. The main features of the Genome U-Plot are its layered layout, its high spatial resolution and its improved aesthetic qualities.&nbsp;</span></p>
<p><span>https://github.com/gaitat/GenomeUPlot</span></p><p>Address of the bookmark: <a href="https://github.com/gaitat/GenomeUPlot" rel="nofollow">https://github.com/gaitat/GenomeUPlot</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37796/grsr-a-tool-for-deriving-genome-rearrangement-scenarios-from-multiple-unichromosomal-genome-sequences</guid>
	<pubDate>Fri, 28 Sep 2018 09:35:10 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37796/grsr-a-tool-for-deriving-genome-rearrangement-scenarios-from-multiple-unichromosomal-genome-sequences</link>
	<title><![CDATA[GRSR: a tool for deriving genome rearrangement scenarios from multiple unichromosomal genome sequences]]></title>
	<description><![CDATA[<p>GRSR is a Tool for Deriving Genome Rearrangement Scenarios for Multiple Uni-chromosomal Genomes. This tool will do the following steps:</p>
<ul>
<li>Step 1. Run mugsy to get multiple sequence alignment results.</li>
<li>Step 2 &amp; 3. Extraction of the Coordinates of Core Blocks, Construction of Synteny Blocks and Generating Signed Permutations.</li>
<li>Step 4. Generate pairwise genome rearrangement scenarios and find repeats at the breakpoints of each rearrangement events.</li>
<li></li>
<li></li>
</ul>
<p>https://github.com/DanwangJessica/GRSR</p><p>Address of the bookmark: <a href="https://github.com/DanwangJessica/GRSR" rel="nofollow">https://github.com/DanwangJessica/GRSR</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38481/arcs-scaffolding-genome-drafts-with-linked-reads</guid>
	<pubDate>Mon, 17 Dec 2018 17:40:28 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38481/arcs-scaffolding-genome-drafts-with-linked-reads</link>
	<title><![CDATA[ARCS: scaffolding genome drafts with linked reads]]></title>
	<description><![CDATA[<p>ARCS requires two input files:</p>
<ul>
<li>Draft assembly fasta file</li>
<li>Interleaved linked reads file (Barcode sequence expected in the BX tag of the read header or in the form "@readname_barcode" ; Run&nbsp;<a href="https://support.10xgenomics.com/genome-exome/software/pipelines/latest/what-is-long-ranger">Long Ranger basic</a>&nbsp;on raw chromium reads to produce this interleaved file)</li>
<li></li>
</ul><p>Address of the bookmark: <a href="https://github.com/bcgsc/ARCS/" rel="nofollow">https://github.com/bcgsc/ARCS/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/38618/canu-genome-assembly-parameters</guid>
	<pubDate>Mon, 07 Jan 2019 08:40:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/38618/canu-genome-assembly-parameters</link>
	<title><![CDATA[CANU genome assembly parameters !]]></title>
	<description><![CDATA[<p>Choose the appropriate parameters to run Canu and run it. The assembly will take about an hour. You can use two cores (parameter&nbsp;<code>-maxThreads=2</code>) and you would like to disable cluster option, since we compute on a single Amazon server set off the option to compute on cluster&nbsp;<code>useGrid=false</code>. This specifications should be for your project discussed with a local computing guru. The parameters that are in square brackets&nbsp;<code>[]</code>&nbsp;are optional, symbol&nbsp;<code>|</code>&nbsp;stands for "or".</p><pre><code>usage:   canu [-correct | -trim | -assemble | -trim-assemble] \
              [-s ] \
               -p  \
               -d  \
               genomeSize=[g|m|k] \
               -maxThreads=2 \
               useGrid=false \
              [other-options] \
               read_file.fastq.gz
</code></pre><p>A default&nbsp;<code>Canu</code>&nbsp;run produces usually high quality assembly, example of a command that was used for testing can be found below. However, there are still a lot of parameters that are possible to tweak. For example if we desire to assemble haplotypes separately of if we want to smash them together, we can alternate the error correction process.</p><pre><code>canu -p test_asmbl \
     -d asm_test3 \
     genomeSize=2m \
     -maxThreads=2 useGrid=false \
     -pacbio-raw \ ~/pacbio/dna/sample_reads.fastq.gz</code></pre><p>There is a brilliant&nbsp;<a href="http://canu.readthedocs.io/en/latest/faq.html#what-parameters-can-i-tweak">section in documentation</a>&nbsp;about parameter tweaking.</p><p>The output directory contains will contain many files. The most interesting ones are:</p><ul>
<li><code>*.correctedReads.fasta.gz</code>&nbsp;: file containing the input sequences after correction, trim and split based on consensus evidence.</li>
<li><code>*.trimmedReads.fastq</code>&nbsp;: file containing the sequences after correction and final trimming</li>
<li><code>*.layout</code>&nbsp;: file containing informations about read inclusion in the final assembly</li>
<li><code>*.gfa</code>&nbsp;: file containing the assembly graph by Canu</li>
<li><code>*.contigs.fasta</code>&nbsp;: file containing everything that could be assembled and is part of the primary assembly</li>
</ul><p>The basic stats of assembly can be read from reports generated by the assembler, or calculated using standard UNIX command line tools.</p><p>More at&nbsp;https://canu.readthedocs.io/en/latest/faq.html</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/30236/pyscaf</guid>
	<pubDate>Mon, 19 Dec 2016 14:20:33 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/30236/pyscaf</link>
	<title><![CDATA[pyScaf]]></title>
	<description><![CDATA[<p>pyScaf orders contigs from genome assemblies utilising several types of information:</p>
<ul>
<li>paired-end (PE) and/or mate-pair libraries (<a href="https://github.com/lpryszcz/pyScaf#ngs-based-scaffolding">NGS-based mode</a>)</li>
<li>long reads (<a href="https://github.com/lpryszcz/pyScaf#scaffolding-based-on-long-reads">NGS-based mode</a>)</li>
<li>synteny to the genome of some related species (<a href="https://github.com/lpryszcz/pyScaf#reference-based-scaffolding">reference-based mode</a>)</li>
</ul>
<p>Scaffolding&nbsp;</p>
<p>In reference-based mode, pyScaf uses synteny to the genome of closely related species in order to order contigs and estimate distances between adjacent contigs.</p>
<p>Contigs are aligned globally (end-to-end) onto reference chromosomes, ignoring:</p>
<ul>
<li>matches not satisfying cut-offs (<code>--identity</code>&nbsp;and&nbsp;<code>--overlap</code>)</li>
<li>suboptimal matches (only best match of each query to reference is kept)</li>
<li>and removing overlapping matches on reference.</li>
</ul>
<p>In preliminary tests, pyScaf performed superbly on simulated heterozygous genomes based on&nbsp;<em>C. parapsilosis</em>&nbsp;(13 Mb; CANPA) and&nbsp;<em>A. thaliana</em>&nbsp;(119 Mb; ARATH) chromosomes, reconstructing correctly all chromosomes always for CANPA and nearly always for ARATH (<a href="https://www.dropbox.com/sh/bb7lwggo40xrwtc/AAAZ7pByVQQQ-WhUXZVeJaZVa/pyScaf?dl=0">Figures in dropbox</a>,&nbsp;<a href="https://docs.google.com/spreadsheets/d/1InBExy-qKDLj-upd8tlPItVSKc4mLepZjZxB31ii9OY/edit#gid=2036953672">CANPA table</a>,&nbsp;<a href="https://docs.google.com/spreadsheets/d/1InBExy-qKDLj-upd8tlPItVSKc4mLepZjZxB31ii9OY/edit#gid=1920757821">ARATH table</a>).<br>Runs took ~0.5 min for CANPA on&nbsp;<code>4 CPUs</code>&nbsp;and ~2 min for ARATH on&nbsp;<code>16 CPUs</code>.</p>
<p><span>Important remarks:</span></p>
<ul>
<li>Reduce your assembly before (fasta2homozygous.py) as any redundancy will likely break the synteny.</li>
<li>pyScaf works better with contigs than scaffolds, as scaffolds are often affected by mis-assemblies (no&nbsp;<em>de novo assembler</em>&nbsp;/ scaffolder is perfect...), which breaks synteny.</li>
<li>pyScaf works very well if divergence between reference genome and assembled contigs is below 20% at nucleotide level.</li>
<li>pyScaf deals with large rearrangements ie. deletions, insertion, inversions, translocations.&nbsp;<span>Note however, this is experimental implementation!</span></li>
<li>Consider closing gaps after scaffolding.</li>
</ul><p>Address of the bookmark: <a href="https://github.com/lpryszcz/pyScaf" rel="nofollow">https://github.com/lpryszcz/pyScaf</a></p>]]></description>
	<dc:creator>Bulbul</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/32481/sspace</guid>
	<pubDate>Fri, 05 May 2017 05:42:15 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/32481/sspace</link>
	<title><![CDATA[SSPACE]]></title>
	<description><![CDATA[<p>SSPACE standard is a stand-alone program for scaffolding pre-assembled contigs using NGS paired-read data. It is unique in offering the possibility to manually control the scaffolding process. By using the distance information of paired-end and/or matepair data, SSPACE is able to assess the order, distance and orientation of your contigs and combine them into scaffolds. Currently we offer this as a command-line tool in Perl. The input data is given by pre-assembled contig sequences (FASTA) and NGS paired-read data (Illumina/454/Solid FASTA or FASTQ). The final scaffolds are provided in FASTA format.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://www.baseclear.com/genomics/bioinformatics/basetools/SSPACE" rel="nofollow">https://www.baseclear.com/genomics/bioinformatics/basetools/SSPACE</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>