BOL: Related items

GoJS

Jit — Tue, 22 Nov 2016 08:25:37 -0600

GoJS is a feature-rich JavaScript library for implementing custom interactive diagrams and complex visualizations across modern web browsers and platforms. GoJS makes constructing JavaScript diagrams of complex nodes, links, and groups easy with customizable templates and layouts.

GoJS offers many advanced features for user interactivity such as drag-and-drop, copy-and-paste, in-place text editing, tooltips, context menus, automatic layouts, templates, data binding and models, transactional state and undo management, palettes, overviews, event handlers, commands, and an extensible tool system for custom operations.

GoJS is pure JavaScript, so users get interactivity without requiring round-trips to servers and without plugins. GoJS normally runs completely in the browser, rendering to an HTML5 Canvas element or SVG without any server-side requirements. GoJS does not depend on any JavaScript libraries or frameworks, so it should work with any HTML or JavaScript framework or with no framework at all.

More at http://gojs.net/latest/index.html

Address of the bookmark: http://gojs.net/latest/index.html

Glia: a Graph/Smith-Waterman (partial order) aligner/realigner

Jit — Tue, 28 Jan 2020 04:02:58 -0600

glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

JumboDB: tool for de Bruijn graph construction

BioStar — Tue, 17 Aug 2021 13:33:46 -0500

jumboDB tool for fast de Bruijn graph construction from long sequences (reads or genomes) with very low error rate. JumboDB is not a genome assembler by itself but rather a subroutine that translates a set of reads into compressed de Bruijn graph.

More at https://github.com/AntonBankevich/jumboDB

Address of the bookmark: https://github.com/AntonBankevich/jumboDB

GFAffix : Identifies walk-preserving shared affixes in variation graphs and collapses them into a non-redundant graph structure.

BioStar — Thu, 28 Aug 2025 03:11:25 -0500

GFAffix identifies walk-preserving shared affixes in variation graphs and collapses them into a non-redundant graph structure.

Address of the bookmark: https://github.com/codialab/GFAffix

Should you get sequenced? Not all bad genes predict disease

Rahul Agarwal — Thu, 29 Aug 2013 15:10:53 -0500

“What we really don’t know yet is whether the predictive aspects of the genome are going to turn out to be beneficial or potentially harmful”

“As we roll out genomic medicine we are fighting against this society-wide misconception that having the bad gene means you’re going to get the disease. That’s only true in a very few cases.”

Source:Today Health

Address of the bookmark: http://www.today.com/health/should-you-get-sequenced-not-all-bad-genes-predict-disease-8C11017154

Two major breakthrough!!

Rahul Agarwal — Mon, 02 Sep 2013 10:18:11 -0500

"Scientists in Uruguay in colloboration with European partners sequenced the genome of the high-value Tannat grape, from which "the most healthy of red wines" are fermented.

A quick, $1 syphilis test in development by researchers from UNU-BIOLAC."

Source:

http://www.sciencedaily.com/releases/2013/09/130902101846.htm

http://www.eurekalert.org/pub_releases/2013-09/tca-ssg082613.php

Encode sequencing data freely available to download and use for academic means

Rahul Agarwal — Thu, 13 Mar 2014 18:18:08 -0500

In Encode, regulatory elements investigated via DNA hypersensitivity assays, assays of DNA methylation, and chromatin immunoprecipitation (ChIP) of proteins that interact with DNA, including modified histones and transcription factors, followed by sequencing (ChIP-Seq).

More information:

https://genome.ucsc.edu/ENCODE/pilot.html

Address of the bookmark: https://genome.ucsc.edu/ENCODE/

Tsetse Fly Genome sequenced

Rahul Agarwal — Fri, 25 Apr 2014 10:48:35 -0500

As it reported online today in Science, the team used several sequencing approaches to tackle the tsetse fly's 366 million base genome.

The current study, and companion articles slated to appear in PLOS One, PLOS Genetics, and PLOS Neglected Tropic Diseases, are the result of nearly 150 researchers based in 18 countries.

Source:

http://www.genomeweb.com/sequencing/international-team-sequences-tsetse-fly-genome

Science for Life Laboratory (SciLifeLab)-Sweden

Sat, 10 May 2014 06:22:30 -0500

Science for Life Laboratory (SciLifeLab) is a national center for molecular biosciences with focus on health and environmental research. The center combines frontline technical expertise with advanced knowledge of translational medicine and molecular bioscience. SciLifeLab is a national resource and a collaboration between four universities: Karolinska Institutet, KTH Royal Institute of Technology, Stockholm University and Uppsala University.

Webpage : https://www.scilifelab.se/about-us/
Opportunity: https://www.scilifelab.se/about-us/career/

Genomics and sequencing approach for identification of biomarkers to assess the efficacy of TGF-βRI inhibitors (of liver cancer) in vivo

Rahul Agarwal — Tue, 05 Aug 2014 13:55:32 -0500

Liver cancer is third leading cause of deaths and fourth most frequent occuring cancer worldwide. There are multiple signaling pathways responsible for causing cancer amongst which TGFb is most important cytokine whose signaling pathway promote cancer. However, main problem is to cure this cancer at late stage where we still have no treatment strategy to tackle this deadly cancer. Hence we need to find out new therapeutic target. One way is to look the relationships between mRNA, methylation and miRNA data of patients with different pathological conditions (cancer vs control either with inhibitor/not). MiRNA is small RNA molecules known to inhibit mRNA expression of particular gene by binding improperly to 3'UTR region of a gene and hence block binding of TF /translation of gene. CpG regions is known to located at promoter region of gene (5' UTR) and usually hypomethylated which allow to gene to transcribe and translate however sometime this region become hyper-methylated thats prevent expression of host gene. Thus , integration of these three data reveal new targets and pathways important for causing or preventing cancer and also reveal biomarker thats check the effects of inhibitor on signaling pathway underlying liver cancer.