<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/37223?offset=640</link>
	<atom:link href="https://bioinformaticsonline.com/related/37223?offset=640" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43376/hisat2-index-files-download</guid>
	<pubDate>Wed, 15 Sep 2021 22:17:49 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43376/hisat2-index-files-download</link>
	<title><![CDATA[HISAT2 Index Files Download !]]></title>
	<description><![CDATA[<p>Resource for downloading all the HISAT2 related files&nbsp;</p>
<p>Please cite:</p>
<blockquote>
<p>Kim, D., Paggi, J.M., Park, C.&nbsp;<em>et al.</em>&nbsp;Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype.&nbsp;<em>Nat Biotechnol</em>&nbsp;<strong>37</strong>, 907&ndash;915 (2019).&nbsp;<a href="https://doi.org/10.1038/s41587-019-0201-4" target="_blank">https://doi.org/10.1038/s41587-019-0201-4</a></p>
</blockquote><p>Address of the bookmark: <a href="http://daehwankimlab.github.io/hisat2/download/#h-sapiens" rel="nofollow">http://daehwankimlab.github.io/hisat2/download/#h-sapiens</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43658/uniquekmer-generate-unique-kmers-for-every-contig-in-a-fasta-file</guid>
	<pubDate>Fri, 17 Dec 2021 00:08:15 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43658/uniquekmer-generate-unique-kmers-for-every-contig-in-a-fasta-file</link>
	<title><![CDATA[UniqueKmer: Generate unique KMERs for every contig in a FASTA file]]></title>
	<description><![CDATA[<p dir="auto">Generate unique k-mers for every contig in a FASTA file.</p>
<p dir="auto">Unique k-mer is consisted of k-mer keys (i.e. ATCGATCCTTAAGG) that are only presented in one contig, but not presented in any other contigs (for both forward and reverse strands).</p>
<p dir="auto">This tool accepts the input of a FASTA file consisting of many contigs, and extract unique k-mers for each contig.</p>
<p dir="auto">The output unique k-mer file and Genome file can be used for fastv:&nbsp;<a href="https://github.com/OpenGene/fastv">https://github.com/OpenGene/fastv</a>, which is an ultra-fast tool to identify and visualize microbial sequences from sequencing data.</p>
<p>https://github.com/OpenGene/UniqueKMER</p><p>Address of the bookmark: <a href="https://github.com/OpenGene/UniqueKMER" rel="nofollow">https://github.com/OpenGene/UniqueKMER</a></p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43725/comparative-genomics-workshops</guid>
	<pubDate>Tue, 25 Jan 2022 20:39:58 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43725/comparative-genomics-workshops</link>
	<title><![CDATA[Comparative Genomics Workshops !]]></title>
	<description><![CDATA[<p><span>This meeting's objective was to obtain a big picture look at the current state of the field of comparative&nbsp;genomics with a focus on commonalities across genomic investigations into humans, model organisms&nbsp;(both traditional and non-traditional), agricultural species, wildlife species and microbes.</span></p>
<p>https://www.genome.gov/event-calendar/perspectives-in-comparative-genomics-and-evolution</p><p>Address of the bookmark: <a href="https://www.genome.gov/event-calendar/perspectives-in-comparative-genomics-and-evolution" rel="nofollow">https://www.genome.gov/event-calendar/perspectives-in-comparative-genomics-and-evolution</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44168/environmental-genomics-group-scilifelabkth-stockholm</guid>
	<pubDate>Thu, 01 Dec 2022 01:12:43 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44168/environmental-genomics-group-scilifelabkth-stockholm</link>
	<title><![CDATA[Environmental Genomics Group SciLifeLab/KTH Stockholm]]></title>
	<description><![CDATA[<p>Useful Metagenomics resources</p><p>Address of the bookmark: <a href="https://github.com/envgen" rel="nofollow">https://github.com/envgen</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44491/cgviewjs-is-a-circular-genome-viewing-tool</guid>
	<pubDate>Wed, 27 Mar 2024 11:16:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44491/cgviewjs-is-a-circular-genome-viewing-tool</link>
	<title><![CDATA[CGView.js is a Circular Genome Viewing tool]]></title>
	<description><![CDATA[<p>CGView.js is a&nbsp;<span>C</span>ircular&nbsp;<span>G</span>enome&nbsp;<span>View</span>ing tool for visualizing and interacting with small genomes. This software is an adaptation of the Java program&nbsp;<a href="https://paulstothard.github.io/cgview/">CGView</a>.</p>
<div>
<p>CGView.js is the genome viewer of Proksee, an expert system for genome assembly, annotation and visualization.</p>
<a href="https://proksee.ca/"></a></div>
<h1 id="features">Features</h1>
<ul>
<li>
<p>Circular and linear views of genomes</p>
</li>
<li>
<p>Capable of drawing genomes up to 10 Mbp with 1000's of features and 100's contigs</p>
</li>
<li>
<p>Smooth zooming down to the sequence level</p>
</li>
<li>
<p>Easily generate features and plots directly form the sequence (e.g. ORFs, GC-content and GC-Skew)</p>
</li>
<li>
<p>Save high resolution PNG maps up to 8000x8000px</p>
</li>
<li>
<p>Fully documented API for interacting with CGView.js maps</p>
</li>
</ul><p>Address of the bookmark: <a href="https://js.cgview.ca/" rel="nofollow">https://js.cgview.ca/</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44703/the-role-of-lncrna-in-bioinformatics-unlocking-the-secrets-of-the-genome</guid>
	<pubDate>Sat, 07 Dec 2024 02:09:47 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44703/the-role-of-lncrna-in-bioinformatics-unlocking-the-secrets-of-the-genome</link>
	<title><![CDATA[The Role of lncRNA in Bioinformatics: Unlocking the Secrets of the Genome]]></title>
	<description><![CDATA[<p>In the intricate dance of molecular biology, long non-coding RNAs (lncRNAs) have emerged as key players, capturing the interest of researchers worldwide. These RNA molecules, once dismissed as "junk," have proven to be vital in the regulation of gene expression, cellular processes, and the progression of diseases. The intersection of lncRNA studies and bioinformatics is transforming our understanding of these enigmatic molecules, offering profound insights into their structure, function, and therapeutic potential.</p><h3>What Are lncRNAs?</h3><p>lncRNAs are RNA transcripts longer than 200 nucleotides that do not code for proteins. Despite their non-coding nature, they play diverse roles in gene regulation, including chromatin remodeling, transcriptional control, and post-transcriptional processing. Unlike messenger RNAs (mRNAs), lncRNAs often function as scaffolds, decoys, or guides in cellular machinery, influencing biological processes such as cell differentiation, immune response, and even cancer metastasis.</p><h3>Challenges in lncRNA Research</h3><p>Identifying and understanding lncRNAs pose unique challenges:</p><ol>
<li><strong>High Sequence Variability</strong>: Unlike protein-coding genes, lncRNAs exhibit low sequence conservation across species, making functional predictions difficult.</li>
<li><strong>Low Expression Levels</strong>: lncRNAs are often expressed at low levels, complicating their detection in transcriptomic data.</li>
<li><strong>Diverse Functions</strong>: The multifunctional nature of lncRNAs requires advanced computational tools to decipher their roles in complex networks.</li>
</ol><h3>Bioinformatics: A Crucial Ally in lncRNA Research</h3><p>Bioinformatics bridges the gap between raw biological data and meaningful insights, making it indispensable in lncRNA research. Here&rsquo;s how:</p><h4>1. <strong>Identification and Annotation</strong></h4><p>High-throughput sequencing technologies like RNA-seq generate vast amounts of data. Bioinformatics tools such as <em>StringTie</em>, <em>Cufflinks</em>, and <em>HISAT2</em> help assemble and annotate lncRNAs from this data. Additionally, databases like NONCODE, LNCipedia, and Ensembl provide curated repositories of lncRNA sequences and annotations.</p><h4>2. <strong>Functional Prediction</strong></h4><p>Bioinformatics algorithms predict the potential functions of lncRNAs by analyzing their interactions with DNA, RNA, and proteins. Tools like LncRNA2Function and RIblast utilize sequence motifs and secondary structure predictions to hypothesize about the roles of specific lncRNAs.</p><h4>3. <strong>Network Construction</strong></h4><p>lncRNAs often act as regulatory hubs. Bioinformatics platforms such as Cytoscape enable the visualization of lncRNA-mediated networks, elucidating their roles in pathways like cell cycle regulation and apoptosis.</p><h4>4. <strong>Epigenetic Studies</strong></h4><p>lncRNAs are known to interact with chromatin-modifying complexes, influencing gene expression epigenetically. Tools like ChIP-seq and ATAC-seq, combined with computational pipelines, identify these interactions and map them to the genome.</p><h4>5. <strong>Clinical Applications</strong></h4><p>Bioinformatics aids in the discovery of lncRNA biomarkers for diseases like cancer and neurodegenerative disorders. Machine learning models analyze differential expression profiles, helping prioritize lncRNAs with therapeutic potential.</p><h3>Case Study: lncRNAs in Cancer Research</h3><p>lncRNAs such as HOTAIR and MALAT1 have been implicated in cancer progression. Bioinformatics analyses have revealed their roles in promoting metastasis and altering the tumor microenvironment. For example, transcriptome analysis in cancer patients identifies lncRNA expression signatures, enabling precision medicine approaches.</p><h3>Future Directions</h3><p>The fusion of bioinformatics with experimental biology is unlocking the secrets of lncRNAs. Advances in artificial intelligence, single-cell sequencing, and structural modeling promise to overcome current limitations. Here are some promising directions:</p><ul>
<li><strong>Integrative Analysis</strong>: Combining multi-omics data to understand the interplay of lncRNAs with other biomolecules.</li>
<li><strong>CRISPR Screens</strong>: Leveraging bioinformatics to design CRISPR-based functional screens for lncRNAs.</li>
<li><strong>Therapeutic Development</strong>: Using bioinformatics to design lncRNA-based therapeutics, including antisense oligonucleotides and RNA interference tools.</li>
</ul><h3>Conclusion</h3><p>lncRNAs are the hidden gems of the genome, and bioinformatics is the key to unearthing their full potential. As research progresses, lncRNAs could pave the way for novel diagnostics, targeted therapies, and personalized medicine, revolutionizing our approach to complex diseases.</p><p>The journey into the world of lncRNAs is only beginning, and bioinformatics will continue to play a pivotal role in decoding these molecular mysteries. Whether you&rsquo;re a researcher, clinician, or bioinformatics enthusiast, the study of lncRNAs offers a fascinating frontier of discovery.</p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44770/nvidia-and-arc-institute-unveil-evo-2-a-breakthrough-ai-for-dna-design</guid>
	<pubDate>Fri, 21 Feb 2025 10:39:47 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44770/nvidia-and-arc-institute-unveil-evo-2-a-breakthrough-ai-for-dna-design</link>
	<title><![CDATA[NVIDIA and Arc Institute Unveil Evo 2: A Breakthrough AI for DNA Design]]></title>
	<description><![CDATA[<p>NVIDIA and the Arc Institute have introduced <strong style="font-size: 12.8px;">Evo 2</strong>, a groundbreaking AI model designed to <strong style="font-size: 12.8px;">understand, predict, and generate DNA sequences</strong>. This marks a major advancement in computational biology, offering scientists an unprecedented tool to decode the genetic blueprint of life and even design entirely new biological systems.</p><h3><strong>The Power of Evo 2: AI Meets DNA</strong></h3><p>Evo 2 is <strong>the largest AI model for biology ever created</strong>, trained on an astonishing <strong>9.3 trillion DNA "letters"</strong> (nucleotides) carefully selected from genomes spanning the entire tree of life. This massive dataset ensures that Evo 2 can recognize patterns and relationships in genetic sequences at an unparalleled scale.</p><p>For the first time, scientists can <strong>design DNA with AI</strong>, moving beyond simple sequence analysis to active DNA generation. Evo 2 enables researchers to <strong>predict, modify, and even create entire genetic sequences</strong>, opening new possibilities in medicine, agriculture, and synthetic biology.</p><h3><strong>Decoding the Dark Genome</strong></h3><p>One of the biggest challenges in genetics is understanding the <strong>non-coding regions</strong> of DNA&mdash;vast stretches of the genome that do not code for proteins but play crucial roles in regulating gene expression. These regions control when and how genes are activated, influencing everything from development to disease.</p><p>Evo 2 is designed to <strong>decode these non-coding elements</strong>, helping researchers uncover their functions and use this knowledge to develop gene-based therapies, synthetic life forms, and precision agriculture solutions.</p><h3><strong>From Reading DNA to Writing It</strong></h3><p>To put Evo 2&rsquo;s impact into perspective:</p><ul>
<li><strong>Previous AI models could "read" DNA</strong> like a book, analyzing genetic sequences and identifying patterns.</li>
<li><strong>Evo 2 can "write" entirely new DNA</strong>, designing functional genes, chromosomes, and even full genomes from scratch.</li>
</ul><p>This means scientists can now <strong>engineer biological systems with AI</strong>, designing new proteins, metabolic pathways, and genetic circuits to address real-world challenges.</p><h3><strong>A Step Toward Generative Biology</strong></h3><p>The Arc Institute describes Evo 2 as a major step toward <strong>"generative biology"</strong>&mdash;a revolutionary approach where AI is used to create <strong>novel biological structures</strong> rather than just analyzing existing ones. This could lead to breakthroughs such as:</p><ul>
<li><strong>New medicines</strong>: AI-generated enzymes and proteins tailored for targeted therapies.</li>
<li><strong>Disease-resistant crops</strong>: Genetically optimized plants for higher yield and climate resilience.</li>
<li><strong>Synthetic organisms</strong>: Custom-designed microbes for bioremediation, biofuel production, and industrial applications.</li>
</ul><h3><strong>An Open-Source Revolution</strong></h3><p>Unlike many proprietary AI models, <strong>Evo 2 is open source</strong>, making its capabilities accessible to researchers worldwide. This democratization of AI-driven biology means that scientists from different disciplines can <strong>collaborate, experiment, and innovate</strong>, accelerating discoveries in genetic engineering and synthetic biology.</p><p>With Evo 2, the boundaries of what&rsquo;s possible in <strong>DNA design, genetic engineering, and biological innovation</strong> are being redrawn. The future of life sciences is no longer just about understanding life&rsquo;s code&mdash;it&rsquo;s about writing it.</p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/29917/gojs</guid>
	<pubDate>Tue, 22 Nov 2016 08:25:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/29917/gojs</link>
	<title><![CDATA[GoJS]]></title>
	<description><![CDATA[<p><strong>GoJS</strong> is a feature-rich JavaScript library for implementing custom interactive diagrams and complex visualizations across modern web browsers and platforms. <strong>GoJS</strong> makes constructing JavaScript diagrams of complex nodes, links, and groups easy with customizable templates and layouts.</p>
<p><strong>GoJS</strong> offers many advanced features for user interactivity such as drag-and-drop, copy-and-paste, in-place text editing, tooltips, context menus, automatic layouts, templates, data binding and models, transactional state and undo management, palettes, overviews, event handlers, commands, and an extensible tool system for custom operations.</p>
<p><strong>GoJS</strong> is pure JavaScript, so users get interactivity without requiring round-trips to servers and without plugins. <strong>GoJS</strong> normally runs completely in the browser, rendering to an HTML5 Canvas element or SVG without any server-side requirements. <strong>GoJS</strong> does not depend on any JavaScript libraries or frameworks, so it should work with any HTML or JavaScript framework or with no framework at all. &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;</p>
<p>More at&nbsp;http://gojs.net/latest/index.html</p><p>Address of the bookmark: <a href="http://gojs.net/latest/index.html" rel="nofollow">http://gojs.net/latest/index.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40713/glia-a-graphsmith-waterman-partial-order-alignerrealigner</guid>
	<pubDate>Tue, 28 Jan 2020 04:02:58 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40713/glia-a-graphsmith-waterman-partial-order-alignerrealigner</link>
	<title><![CDATA[Glia: a Graph/Smith-Waterman (partial order) aligner/realigner]]></title>
	<description><![CDATA[<p><span>glia's main use is as a local realigner. It will realign reads to a set of known (or putative) variants in a VCF, both consuming and producing an ordered stream of BAM alignments.&nbsp;</span></p>
<p><span>More at&nbsp;<a href="https://github.com/ekg/glia">https://github.com/ekg/glia</a></span></p>
<pre><code>glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA</code></pre><p>Address of the bookmark: <a href="https://github.com/ekg/glia" rel="nofollow">https://github.com/ekg/glia</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43263/jumbodb-tool-for-de-bruijn-graph-construction</guid>
	<pubDate>Tue, 17 Aug 2021 13:33:46 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43263/jumbodb-tool-for-de-bruijn-graph-construction</link>
	<title><![CDATA[JumboDB: tool for de Bruijn graph construction]]></title>
	<description><![CDATA[<p><span>jumboDB tool for fast de Bruijn graph construction from long sequences (reads or genomes) with very low error rate. JumboDB is not a genome assembler by itself but rather a subroutine that translates a set of reads into compressed de Bruijn graph.</span></p>
<p><span>More at&nbsp;https://github.com/AntonBankevich/jumboDB</span></p><p>Address of the bookmark: <a href="https://github.com/AntonBankevich/jumboDB" rel="nofollow">https://github.com/AntonBankevich/jumboDB</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>

</channel>
</rss>