1. RNA-Seq Analysis Pipelines

RNA-seq is one of the most popular techniques for studying RNA. These tools streamline processing raw sequence data:

• FASTQC: For quality control of raw RNA-seq reads.
• Trimmomatic: For trimming and filtering RNA-seq reads.
• HISAT2/STAR: High-performance aligners for RNA-seq reads.
• FeatureCounts: For quantifying gene expression.
• DESeq2/EdgeR: For differential expression analysis.

2. Transcriptome Assembly and Annotation

For analyzing transcriptomes from non-model organisms or assembling novel transcripts:

• Trinity: For de novo transcriptome assembly.
• StringTie: For transcript assembly and quantification from RNA-seq alignments.
• TransDecoder: To predict coding regions within assembled transcripts.
• TAU: Tools for annotating non-coding and coding RNAs.

3. Exploring Non-Coding RNA (ncRNA)

Non-coding RNAs play critical regulatory roles. Dedicated tools for studying them include:

• Infernal: For identifying ncRNA sequences based on covariance models.
• Rfam: Database and tools for ncRNA families.
• miRDeep: For identifying microRNAs in RNA-seq datasets.

4. RNA Structure and Motif Analysis

Structural biology of RNA helps in understanding its function:

• RNAfold (ViennaRNA): Predicts secondary structures from RNA sequences.
• RNAstructure: Tools for RNA secondary structure prediction and analysis.
• MEME Suite: For identifying motifs in RNA sequences.
• IntaRNA: For RNA-RNA interaction prediction.

5. RNA Editing and Modifications

Epitranscriptomics is a growing field focusing on RNA modifications:

• REDItools: For RNA editing analysis.
• m6Aboost: For identifying m6A modifications in RNA.

6. Long-Read RNA Sequencing Analysis

Long-read technologies like Nanopore and PacBio are transforming RNA research:

• FLAIR: For isoform-level analysis of long-read RNA-seq data.
• NanoMod: For detecting modifications in RNA from Nanopore sequencing.

7. RNA-Protein Interactions

To study RNA-protein interactions and complexes:

• RBPmap: For identifying RNA-binding protein motifs.
• PARalyzer: For analyzing PAR-CLIP data.

8. Functional Enrichment Analysis

Understanding biological functions and pathways from RNA-seq data:

• getENRICH: A tool designed for pathway enrichment analysis of non-model organisms (hypergeometric P-value calculation with FDR correction).
• ClusterProfiler: For GO and KEGG pathway enrichment analysis.

9. Visualization and Data Sharing

Presenting and sharing RNA sequence analysis results effectively:

• IGV: Genome browser for visualizing RNA-seq alignments.
• Circos: Circular visualization of RNA-seq data.
• DashBio: A Python library for creating bioinformatics visualizations.

Conclusion

The bioinformatics landscape for RNA sequence analysis is vast, with tools catering to specific needs. Whether you’re studying coding RNAs, non-coding RNAs, or exploring RNA-protein interactions, the right tools can transform your data into biological insights.

Details:
Session 1: 28 Feb 2018, 9 AM CET
Session 2: 28 Feb 2018, 8 AM PST
Register here: http://www.strand-ngs.com/webinar_registration

About Speaker:

Dr. Suman Kapoor, Manager- Application Science at Strand Life Sciences, has over 11 years experience in molecular biology, next-generation sequencing based testing, clinical genomics, and personalized medicine for disease management and prenatal testing. Dr. Suman holds a Ph.D in Molecular and Cell Biology from Indian Institute of Science, Bangalore. Prior to joining Strand NGS team, Suman has worked extensively on protein synthesis in eubacteria and has experience working in CAP and NABL accredited lab validating and interpreting NGS based diagnostic tests.

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

Address of the bookmark: https://github.com/rrwick/Unicycler

Again, running spades.py will show you the options:

spades.py

This produces:

SPAdes genome assembler v3.10.1

Usage: /usr/local/SPAdes-3.10.1-Linux/bin/spades.py [options] -o <output_dir>

Basic options:
-o      <output_dir>    directory to store all the resulting files (required)
--sc                    this flag is required for MDA (single-cell) data
--meta                  this flag is required for metagenomic sample data
--rna                   this flag is required for RNA-Seq data
--plasmid               runs plasmidSPAdes pipeline for plasmid detection
--iontorrent            this flag is required for IonTorrent data
--test                  runs SPAdes on toy dataset
-h/--help               prints this usage message
-v/--version            prints version

Input data:
--12    <filename>      file with interlaced forward and reverse paired-end reads
-1      <filename>      file with forward paired-end reads
-2      <filename>      file with reverse paired-end reads
-s      <filename>      file with unpaired reads
--pe<#>-12      <filename>      file with interlaced reads for paired-end library number <#> (<#> = 1,2,..,9)
--pe<#>-1       <filename>      file with forward reads for paired-end library number <#> (<#> = 1,2,..,9)
--pe<#>-2       <filename>      file with reverse reads for paired-end library number <#> (<#> = 1,2,..,9)
--pe<#>-s       <filename>      file with unpaired reads for paired-end library number <#> (<#> = 1,2,..,9)
--pe<#>-<or>    orientation of reads for paired-end library number <#> (<#> = 1,2,..,9; <or> = fr, rf, ff)
--s<#>          <filename>      file with unpaired reads for single reads library number <#> (<#> = 1,2,..,9)
--mp<#>-12      <filename>      file with interlaced reads for mate-pair library number <#> (<#> = 1,2,..,9)
--mp<#>-1       <filename>      file with forward reads for mate-pair library number <#> (<#> = 1,2,..,9)
--mp<#>-2       <filename>      file with reverse reads for mate-pair library number <#> (<#> = 1,2,..,9)
--mp<#>-s       <filename>      file with unpaired reads for mate-pair library number <#> (<#> = 1,2,..,9)
--mp<#>-<or>    orientation of reads for mate-pair library number <#> (<#> = 1,2,..,9; <or> = fr, rf, ff)
--hqmp<#>-12    <filename>      file with interlaced reads for high-quality mate-pair library number <#> (<#> = 1,2,..,9)
--hqmp<#>-1     <filename>      file with forward reads for high-quality mate-pair library number <#> (<#> = 1,2,..,9)
--hqmp<#>-2     <filename>      file with reverse reads for high-quality mate-pair library number <#> (<#> = 1,2,..,9)
--hqmp<#>-s     <filename>      file with unpaired reads for high-quality mate-pair library number <#> (<#> = 1,2,..,9)
--hqmp<#>-<or>  orientation of reads for high-quality mate-pair library number <#> (<#> = 1,2,..,9; <or> = fr, rf, ff)
--nxmate<#>-1   <filename>      file with forward reads for Lucigen NxMate library number <#> (<#> = 1,2,..,9)
--nxmate<#>-2   <filename>      file with reverse reads for Lucigen NxMate library number <#> (<#> = 1,2,..,9)
--sanger        <filename>      file with Sanger reads
--pacbio        <filename>      file with PacBio reads
--nanopore      <filename>      file with Nanopore reads
--tslr  <filename>      file with TSLR-contigs
--trusted-contigs       <filename>      file with trusted contigs
--untrusted-contigs     <filename>      file with untrusted contigs

Pipeline options:
--only-error-correction runs only read error correction (without assembling)
--only-assembler        runs only assembling (without read error correction)
--careful               tries to reduce number of mismatches and short indels
--continue              continue run from the last available check-point
--restart-from  <cp>    restart run with updated options and from the specified check-point ('ec', 'as', 'k<int>', 'mc')
--disable-gzip-output   forces error correction not to compress the corrected reads
--disable-rr            disables repeat resolution stage of assembling

Advanced options:
--dataset       <filename>      file with dataset description in YAML format
-t/--threads    <int>           number of threads
                                [default: 16]
-m/--memory     <int>           RAM limit for SPAdes in Gb (terminates if exceeded)
                                [default: 250]
--tmp-dir       <dirname>       directory for temporary files
                                [default: <output_dir>/tmp]
-k              <int,int,...>   comma-separated list of k-mer sizes (must be odd and
                                less than 128) [default: 'auto']
--cov-cutoff    <float>         coverage cutoff value (a positive float number, or 'auto', or 'off') [default: 'off']
--phred-offset  <33 or 64>      PHRED quality offset in the input reads (33 or 64)
                                [default: auto-detect]

As you can see this is also a “pipeline” of tools that can be switched on or off. SPAdes takes quite a long time, so for the purposes of this practical, something like this may suffice:

spades.py -t 4 \
          -m 32 \
          -k 31,51,71 \
          --only-assembler \
          -1 miseq.1.fastq -2 miseq.2.fastq \
          --nanopore minion.fastq \
          -o hybrid_assembly

In turn, these parameters mean

• use 4 threads
• max memory is 32Gb
• use 3 kmer values to build the de bruijn graph(s) - 31, 51 and 71
• only run the assembler, not the correction algorithm (for speed)
• read 1 and read 2 of the MiSeq data
• the nanopore data
• put the output in folder “hybrid_assembly”

Following are the genome assembly tools based on string graph:

1.SGA (String Graph Assembler) https://github.com/jts/sga

Assembles large genomes from high coverage short read data. SGA is designed as a modular set of programs, which are used to form an assembly pipeline. SGA implements a set of assembly algorithms based on the FM-index. As the FM-index is a compressed data structure, the algorithms are very memory efficient. The SGA assembly has three distinct phases. The first phase corrects base calling errors in the reads. The second phase assembles contigs from the corrected reads. The third phase uses paired end and/or mate pair data to build scaffolds from the contigs. The output of this software is a PDF report that allows the properties of the genome and data quality to be visually explored. By providing more information to the user at the start of an assembly project, this software will help increase awareness of the factors that make a given assembly easy or difficult, assist in the selection of software and parameters and help to troubleshoot an assembly if it runs into problems.

2. SAGE: String-overlap Assembly of GEnomes https://github.com/lucian-ilie/SAGE2

SAGE, for de novo genome assembly. As opposed to most assemblers, which are de Bruijn graph based, SAGE uses the string-overlap graph. SAGE builds upon great existing work on string-overlap graph and maximum likelihood assembly, bringing an important number of new ideas, such as the efficient computation of the transitive reduction of the string overlap graph, the use of (generalized) edge multiplicity statistics for more accurate estimation of read copy counts, and the improved use of mate pairs and min-cost flow for supporting edge merging. The assemblies produced by SAGE for several short and medium-size genomes compared favourably with those of existing leading assemblers.

3. FSG: Fast String Graph

The new integrated assembler has been assessed on a standard benchmark, showing that fast string graph (FSG) is significantly faster than SGA while maintaining a moderate use of main memory, and showing practical advantages in running FSG on multiple threads. Moreover, we have studied the effect of coverage rates on the running times.

4.  BASE https://github.com/dhlbh/BASE

It enhances the classic seed-extension approach by indexing the reads efficiently to generate adaptive seeds that have high probability to appear uniquely in the genome. Such seeds form the basis for BASE to build extension trees and then to use reverse validation to remove the branches based on read coverage and paired-end information, resulting in high-quality consensus sequences of reads sharing the seeds. Such consensus sequences are then extended to contigs. BASE is a practically efficient tool for constructing contig, with significant improvement in quality for long NGS reads. It is relatively easy to extend BASE to include scaffolding.

5. Fermi https://github.com/lh3/fermi/

Fermi is a de novo assembler with a particular focus on assembling Illumina short sequence reads from a mammal-sized genome. In addition to the role of a typical assembler, fermi also aims to preserve heterozygotes which are often collapsed by other assemblers. Its ultimate goal is to find a minimal set of unitigs to represent all the information in raw reads.

If you want to learn about String Graph assembler, please read the following papers -

i) The Fragment Assembly String Graph - E. W. Myers

This paper describes the String Graph concept.

ii) Efficient construction of an assembly string graph using the FM-index - Jared T. Simpson and Richard Durbin

This earlier paper from Simpson and Durbin

iii) Efficient de novo assembly of large genomes using compressed data structures - Jared T. Simpson and Richard Durbin

y a number of metrics, including:

• Overall assembly length
• Number of scaffolds/contigs
• Length of longest scaffold/contig
• Scaffold/contig N50 and N90Assembly base composition, in particular percentage GC and percentage Ns
• CEGMA completeness
• Scaffold/contig length/count distribution

assembly-stats supports two widely used presentations of these values, tabular and cumulative length plots, and introduces an additional circular plot that summarises most commonly used assembly metrics in a single visualisation. Each of these presentations is generated using javascript from a common (JSON) data structure, allowing toggling between alternative views, and each can be applied to a single or multiple assemblies to allow direct comparison of alternate assemblies.

Tabular presentation allows direct comparison of exact values between assemblies, the limitations of this approach lie in the necessary omission of distributions and the challenge of interpreting ratios of values that may vary by several orders of magnitude.

Address of the bookmark: https://github.com/rjchallis/assembly-stats

Source code, executables and the testing dataset are freely available at https://github.com/mapleforest/HaploMerger2/releases/.

Address of the bookmark: https://github.com/mapleforest/HaploMerger2/releases/