Details:
Session 1: 28 Feb 2018, 9 AM CET
Session 2: 28 Feb 2018, 8 AM PST
Register here: http://www.strand-ngs.com/webinar_registration

About Speaker:

Dr. Suman Kapoor, Manager- Application Science at Strand Life Sciences, has over 11 years experience in molecular biology, next-generation sequencing based testing, clinical genomics, and personalized medicine for disease management and prenatal testing. Dr. Suman holds a Ph.D in Molecular and Cell Biology from Indian Institute of Science, Bangalore. Prior to joining Strand NGS team, Suman has worked extensively on protein synthesis in eubacteria and has experience working in CAP and NABL accredited lab validating and interpreting NGS based diagnostic tests.

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

• Assembly of nanopore reads using Canu.
• Polish canu contigs using racon (optional).
• Map a paired-end Illumina dataset onto the contigs obtained in the previous steps using BWA mem.
• Perform correction of contigs using pilon and the Illumina dataset.

Address of the bookmark: https://github.com/nanoporetech/ont-assembly-polish

• dnaPipeTE is developped by Clément Goubert, Laurent Modolo and the TREEP team of the LBBE: http://lbbe.univ-lyon1.fr/-Equipe-Elements-transposables-.html?lang=en

• You can find the original publication in GBE here: https://academic.oup.com/gbe/article/7/4/1192/533768

output examples of quantification and TE landscape (relative age) produced by dnaPipeTE

Address of the bookmark: https://github.com/clemgoub/dnaPipeTE

Ra is in development since 2014 in the form of several separate components that used to be run individually.
This project aims to ease the usage of Ra by integrating it into a complete de novo assembly tool.

Unlike other state-of-the-art assemblers, Ra does not have an error correction step. Instead, it relies on detecting overlaps using a very sensitive and specific overlapper ("graphmap -w owler", https://github.com/isovic/graphmap) and constructing and reducing an overlap graph (Ra layout, https://github.com/mariokostelac/ra).

Address of the bookmark: https://github.com/mariokostelac/ra-integrate/

Using AlignGraph

AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]

Address of the bookmark: https://github.com/baoe/AlignGraph

The tool should be compatible with most UNIX flavors and has been successfully tested on the following operating systems:

• Mac OS X 10.11.1
• Mac OS X 10.10.3
• Ubuntu 14.04 LTS

Address of the bookmark: https://github.com/mculinovic/EAGLER

This script has been modified by others to convert InDels as well, e.g. this by David Eccles

./vcf2fq.pl -f <input.fasta> <all-site.vcf> > <output.fastq>

https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl

https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl

Source code for SKESA is freely available at https://github.com/ncbi/SKESA/releases.

Research Paper @ Link

SKESA algorithm are as follows:

Address of the bookmark: https://github.com/ncbi/SKESA/releases