• Inchworm assembles the RNA-seq data into the unique sequences of transcripts, often generating full-length transcripts for a dominant isoform, but then reports just the unique portions of alternatively spliced transcripts.

• Chrysalis clusters the Inchworm contigs into clusters and constructs complete de Bruijn graphs for each cluster. Each cluster represents the full transcriptonal complexity for a given gene (or sets of genes that share sequences in common). Chrysalis then partitions the full read set among these disjoint graphs.

• Butterfly then processes the individual graphs in parallel, tracing the paths that reads and pairs of reads take within the graph, ultimately reporting full-length transcripts for alternatively spliced isoforms, and teasing apart transcripts that corresponds to paralogous genes.

More at https://github.com/trinityrnaseq/trinityrnaseq/wiki

......................................................................................................................................

Download Trinity here.

Build Trinity by typing 'make' in the base installation directory.

Assemble RNA-Seq data like so:

 Trinity --seqType fq --left reads_1.fq --right reads_2.fq --CPU 6 --max_memory 20G 

Find assembled transcripts as: 'trinity_out_dir/Trinity.fasta'

Address of the bookmark: https://github.com/trinityrnaseq/trinityrnaseq/wiki

➜ cd trinityrnaseq-Trinity-v2.6.6

➜ trinityrnaseq-Trinity-v2.6.6 git:(master) ✗ make
Using gnu compiler for Inchworm and Chrysalis
cd Inchworm && (test -e configure || autoreconf) \
&& sh ./configure --prefix=`pwd` && make install
checking for a BSD-compatible install... /usr/bin/install -c
checking whether build environment is sane... yes
checking for a thread-safe mkdir -p... /bin/mkdir -p
checking for gawk... gawk
checking whether make sets $(MAKE)... yes
checking for g++... g++
checking whether the C++ compiler works... yes
checking for C++ compiler default output file name... a.out
checking for suffix of executables...
checking whether we are cross compiling... no
checking for suffix of object files... o
checking whether we are using the GNU C++ compiler... yes
checking whether g++ accepts -g... yes
checking for style of include used by make... GNU
checking dependency style of g++... gcc3
checking for library containing cos... none required
configure: creating ./config.status
config.status: creating Makefile
config.status: creating src/Makefile
config.status: creating config.h
config.status: config.h is unchanged
config.status: executing depfiles commands
make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
Making install in src
make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Fasta_entry.o -MD -MP -MF .deps/Fasta_entry.Tpo -c -o Fasta_entry.o Fasta_entry.cpp
mv -f .deps/Fasta_entry.Tpo .deps/Fasta_entry.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT IRKE_run.o -MD -MP -MF .deps/IRKE_run.Tpo -c -o IRKE_run.o IRKE_run.cpp
mv -f .deps/IRKE_run.Tpo .deps/IRKE_run.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT sequenceUtil.o -MD -MP -MF .deps/sequenceUtil.Tpo -c -o sequenceUtil.o sequenceUtil.cpp
mv -f .deps/sequenceUtil.Tpo .deps/sequenceUtil.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT IRKE.o -MD -MP -MF .deps/IRKE.Tpo -c -o IRKE.o IRKE.cpp
mv -f .deps/IRKE.Tpo .deps/IRKE.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT KmerCounter.o -MD -MP -MF .deps/KmerCounter.Tpo -c -o KmerCounter.o KmerCounter.cpp
mv -f .deps/KmerCounter.Tpo .deps/KmerCounter.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT string_util.o -MD -MP -MF .deps/string_util.Tpo -c -o string_util.o string_util.cpp
mv -f .deps/string_util.Tpo .deps/string_util.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Fasta_reader.o -MD -MP -MF .deps/Fasta_reader.Tpo -c -o Fasta_reader.o Fasta_reader.cpp
mv -f .deps/Fasta_reader.Tpo .deps/Fasta_reader.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT stacktrace.o -MD -MP -MF .deps/stacktrace.Tpo -c -o stacktrace.o stacktrace.cpp
mv -f .deps/stacktrace.Tpo .deps/stacktrace.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT argProcessor.o -MD -MP -MF .deps/argProcessor.Tpo -c -o argProcessor.o argProcessor.cpp
mv -f .deps/argProcessor.Tpo .deps/argProcessor.Po
g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -o inchworm Fasta_entry.o IRKE_run.o sequenceUtil.o IRKE.o KmerCounter.o string_util.o Fasta_reader.o stacktrace.o argProcessor.o
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT cigar_tweaker.o -MD -MP -MF .deps/cigar_tweaker.Tpo -c -o cigar_tweaker.o cigar_tweaker.cpp
mv -f .deps/cigar_tweaker.Tpo .deps/cigar_tweaker.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT SAM_entry.o -MD -MP -MF .deps/SAM_entry.Tpo -c -o SAM_entry.o SAM_entry.cpp
mv -f .deps/SAM_entry.Tpo .deps/SAM_entry.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT SAM_reader.o -MD -MP -MF .deps/SAM_reader.Tpo -c -o SAM_reader.o SAM_reader.cpp
mv -f .deps/SAM_reader.Tpo .deps/SAM_reader.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT Cigar.o -MD -MP -MF .deps/Cigar.Tpo -c -o Cigar.o Cigar.cpp
mv -f .deps/Cigar.Tpo .deps/Cigar.Po
g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -o cigar_tweaker cigar_tweaker.o SAM_entry.o sequenceUtil.o SAM_reader.o Cigar.o string_util.o stacktrace.o Fasta_reader.o Fasta_entry.o
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT pull_reads_with_kmers.o -MD -MP -MF .deps/pull_reads_with_kmers.Tpo -c -o pull_reads_with_kmers.o pull_reads_with_kmers.cpp
mv -f .deps/pull_reads_with_kmers.Tpo .deps/pull_reads_with_kmers.Po
g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -o pull_reads_with_kmers pull_reads_with_kmers.o Fasta_reader.o Fasta_entry.o sequenceUtil.o KmerCounter.o string_util.o stacktrace.o argProcessor.o
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT FastaToDeBruijn.o -MD -MP -MF .deps/FastaToDeBruijn.Tpo -c -o FastaToDeBruijn.o FastaToDeBruijn.cpp
FastaToDeBruijn.cpp: In function ‘void createGraphPerRecord(std::vector >, int, bool, ArgProcessor)’:
FastaToDeBruijn.cpp:199:39: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (seq_region.size() < kmer_length) { continue; } // can be e
^
mv -f .deps/FastaToDeBruijn.Tpo .deps/FastaToDeBruijn.Po
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT DeBruijnGraph.o -MD -MP -MF .deps/DeBruijnGraph.Tpo -c -o DeBruijnGraph.o DeBruijnGraph.cpp
mv -f .deps/DeBruijnGraph.Tpo .deps/DeBruijnGraph.Po
g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -o FastaToDeBruijn FastaToDeBruijn.o argProcessor.o Fasta_reader.o Fasta_entry.o sequenceUtil.o string_util.o stacktrace.o DeBruijnGraph.o
g++ -DHAVE_CONFIG_H -I. -I.. -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -MT fastaToKmerCoverageStats.o -MD -MP -MF .deps/fastaToKmerCoverageStats.Tpo -c -o fastaToKmerCoverageStats.o fastaToKmerCoverageStats.cpp
fastaToKmerCoverageStats.cpp: In function ‘void populate_kmer_counter_from_reads(KmerCounter&, std::__cxx11::string&)’:
fastaToKmerCoverageStats.cpp:226:18: warning: unused variable ‘kmer_length’ [-Wunused-variable]
unsigned int kmer_length = kcounter.get_kmer_length();
^
mv -f .deps/fastaToKmerCoverageStats.Tpo .deps/fastaToKmerCoverageStats.Po
g++ -std=c++0x -pedantic -fopenmp -Wall -Wextra -Wno-deprecated -m64 -g -O2 -o fastaToKmerCoverageStats fastaToKmerCoverageStats.o argProcessor.o Fasta_reader.o Fasta_entry.o sequenceUtil.o string_util.o stacktrace.o KmerCounter.o
make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'
test -z "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin" || /bin/mkdir -p "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin"
/usr/bin/install -c inchworm cigar_tweaker pull_reads_with_kmers FastaToDeBruijn fastaToKmerCoverageStats '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/bin'
make[3]: Nothing to be done for 'install-data-am'.
make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'
make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm/src'
make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
make[3]: Nothing to be done for 'install-exec-am'.
make[3]: Nothing to be done for 'install-data-am'.
make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Inchworm'
cd Chrysalis && make UNSUPPORTED=yes
make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Chrysalis'
./MakeDepend.cc: In member function ‘bool makefile_builder::dependency::operator<(const makefile_builder::dependency&) const’:
./MakeDepend.cc:93:47: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
dependent_ == other.dependent_ &&
^
./MakeDepend.cc: In member function ‘bool makefile_builder::subdir_and_target::operator<(const makefile_builder::subdir_and_target&) const’:
./MakeDepend.cc:130:41: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
subdir_ == other.subdir_ &&
^
./MakeDepend.cc: In function ‘int main(int, char**)’:
./MakeDepend.cc:223:20: warning: deprecated conversion from string constant to ‘char*’ [-Wwrite-strings]
char * options = "Ad:g:u:fh";
^
./MakeDepend.cc: In member function ‘void makefile_builder::DumpDependencies(const string&)’:
./MakeDepend.cc:491:46: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
if ( ! this->FileIsSource( dependent ) && ! this->FileIsHeader( dependent
^
./MakeDepend.cc:493:44: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
this->FileIsHeader( dependent ) && this->FileIsSource( provider ) )
^
./MakeDepend.cc: In member function ‘bool makefile_builder::FileIsHeader(const string&) const’:
./MakeDepend.cc:1339:32: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
return ( filename.size() > 2 &&
^
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:04 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./aligns/KmerAlignCore.cc -o obj/aligns/KmerAlignCore.o
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:06 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/AACodons.cc -o obj/analysis/AACodons.o
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:09 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/BreakTransByPairs.cc -o obj/analysis/BreakTransByPairs.o
./analysis/BreakTransByPairs.cc: In function ‘int main(int, char**)’:
./analysis/BreakTransByPairs.cc:105:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i > DeBruijnGraph::get_candidate_weldmers(kmer_int_type_t, int)’:
./analysis/DeBruijnGraph.cc:473:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int i = 0; i < left_extensions.size(); i++) {
^
./analysis/DeBruijnGraph.cc:476:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int j = 0; j < right_extensions.size(); j++) {
^
./analysis/DeBruijnGraph.cc: In member function ‘void DeBruijnGraph::recursively_construct_kmer_extensions(kmer_int_type_t, std::vector&, std::vector >&, char, std::map&, int)’:
./analysis/DeBruijnGraph.cc:513:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int i = 0; i < adjacent_kmers.size(); i++) {
^
./analysis/DeBruijnGraph.cc:527:41: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (kmer_extension_chars.size() == flank_extension_length) {
^
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:30 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/sequenceUtil.cc -o obj/analysis/sequenceUtil.o
./analysis/sequenceUtil.cc: In function ‘bool contains_non_gatc(std::__cxx11::string)’:
./analysis/sequenceUtil.cc:33:20: warning: array subscript has type ‘char’ [-Wchar-subscripts]
if (_base_to_int[c] > 3)
^
./analysis/sequenceUtil.cc: In function ‘kmer_int_type_t kmer_to_intval(std::__cxx11::string)’:
./analysis/sequenceUtil.cc:264:26: warning: array subscript has type ‘char’ [-Wchar-subscripts]
int val = _base_to_int[c];
^
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:31 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/stacktrace.cc -o obj/analysis/stacktrace.o
/bin/rm -f lib_BubbleUpClustering_temp.a
ar -qc lib_BubbleUpClustering_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/BubbleUpClustering.o obj/analysis/DNAVector.o obj/analysis/DeBruijnGraph.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/sequenceUtil.o obj/analysis/stacktrace.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./BubbleUpClustering
g++ -ggdb3 -fopenmp -o ./BubbleUpClustering obj/analysis/BubbleUpClustering.o -L. -lm -pthread -l_BubbleUpClustering_temp
/bin/rm lib_BubbleUpClustering_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:32 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/Chrysalis.cc -o obj/analysis/Chrysalis.o
./analysis/Chrysalis.cc: In function ‘int main(int, char**)’:
./analysis/Chrysalis.cc:384:28: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]
system(command.c_str());
^
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:35 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/TranscriptomeGraph.cc -o obj/analysis/TranscriptomeGraph.o
./analysis/TranscriptomeGraph.cc: In function ‘int TranscriptomeGraph(vecDNAVector&, FILE*, int, bool)’:
./analysis/TranscriptomeGraph.cc:668:20: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i<=d.isize()-k; i++) {
^
/bin/rm -f lib_Chrysalis_temp.a
ar -qc lib_Chrysalis_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/Chrysalis.o obj/analysis/DNAVector.o obj/analysis/TranscriptomeGraph.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./Chrysalis
g++ -ggdb3 -fopenmp -o ./Chrysalis obj/analysis/Chrysalis.o -L. -lm -pthread -l_Chrysalis_temp
/bin/rm lib_Chrysalis_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:39 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/CreateIwormFastaBundle.cc -o obj/analysis/CreateIwormFastaBundle.o
/bin/rm -f lib_CreateIwormFastaBundle_temp.a
ar -qc lib_CreateIwormFastaBundle_temp.a obj/analysis/AACodons.o obj/analysis/CreateIwormFastaBundle.o obj/analysis/DNAVector.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./CreateIwormFastaBundle
g++ -ggdb3 -fopenmp -o ./CreateIwormFastaBundle obj/analysis/CreateIwormFastaBundle.o -L. -lm -pthread -l_CreateIwormFastaBundle_temp
/bin/rm lib_CreateIwormFastaBundle_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:42 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/GraphFromFasta.cc -o obj/analysis/GraphFromFasta.o
./analysis/GraphFromFasta.cc: In function ‘bool SimpleHalves(const DNAVector&)’:
./analysis/GraphFromFasta.cc:255:15: warning: suggest parentheses around ‘&&’ within ‘||’ [-Wparentheses]
&&
^
./analysis/GraphFromFasta.cc: In function ‘void report_iworm_graph(std::map<int, Pool>&, std::map&)’:
./analysis/GraphFromFasta.cc:631:31: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int j = 0; j < adjacent_nodes.size(); j++) {
^
./analysis/GraphFromFasta.cc: In function ‘int main(int, char**)’:
./analysis/GraphFromFasta.cc:1164:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i bubble_up_cluster_growth(std::map&, std::map&)’:
./GraphFromFasta_MPI.cc:706:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int i = 0; i < pool_vec.size(); i++) {
^
./GraphFromFasta_MPI.cc:727:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int i = 0; i < pool_vec.size(); i++) {
^
./GraphFromFasta_MPI.cc:834:23: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int i = 0; i < pool_vec.size(); i++) {
^
./GraphFromFasta_MPI.cc: In function ‘void add_unclustered_iworm_contigs(svec&, vecDNAVector&)’:
./GraphFromFasta_MPI.cc:1144:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (size_t i = 0; i < p.size(); i++) {
^
./GraphFromFasta_MPI.cc: In function ‘int main(int, char**)’:
./GraphFromFasta_MPI.cc:1453:60: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (iworm_counter % 1000 == 0 || iworm_counter == dna.size()-1) {
^
./GraphFromFasta_MPI.cc:1458:24: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (j=0; j<=d.isize()-k; j++) {
^
./GraphFromFasta_MPI.cc:1479:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (c == i)
^
./GraphFromFasta_MPI.cc:1503:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (c == i)
^
./GraphFromFasta_MPI.cc:2235:24: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (j=0; j<=d.isize()-k; j++) {
^
./GraphFromFasta_MPI.cc:2264:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (c == i) {
^
./GraphFromFasta_MPI.cc:2359:27: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
if (c == i) {
^
./GraphFromFasta_MPI.cc:2475:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i<clustered_pools.isize(); i++) {
^
./GraphFromFasta_MPI.cc:2483:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (size_t j = 0; j < p.size(); j++) {
^
./GraphFromFasta_MPI.cc:2496:30: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (size_t j = 0; j < p.size(); j++) {
^
/bin/rm -f lib_GraphFromFasta_MPI_temp.a
ar -qc lib_GraphFromFasta_MPI_temp.a obj/GraphFromFasta_MPI.o obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/DeBruijnGraph.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/sequenceUtil.o obj/analysis/stacktrace.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./GraphFromFasta_MPI
g++ -ggdb3 -fopenmp -o ./GraphFromFasta_MPI obj/GraphFromFasta_MPI.o -L. -lm -pthread -l_GraphFromFasta_MPI_temp
/bin/rm lib_GraphFromFasta_MPI_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:53 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/IsoformAugment.cc -o obj/analysis/IsoformAugment.o
./analysis/IsoformAugment.cc: In function ‘int main(int, char**)’:
./analysis/IsoformAugment.cc:87:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (j=0; j<matchesLeft.isize(); j++) {
^
./analysis/IsoformAugment.cc:122:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (j=0; j<matches.isize(); j++) {
^
/bin/rm -f lib_IsoformAugment_temp.a
ar -qc lib_IsoformAugment_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/IsoformAugment.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./IsoformAugment
g++ -ggdb3 -fopenmp -o ./IsoformAugment obj/analysis/IsoformAugment.o -L. -lm -pthread -l_IsoformAugment_temp
/bin/rm lib_IsoformAugment_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:27:56 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/JoinTransByPairs.cc -o obj/analysis/JoinTransByPairs.o
./analysis/JoinTransByPairs.cc: In function ‘int main(int, char**)’:
./analysis/JoinTransByPairs.cc:293:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i<dna.size(); i++) {
^
./analysis/JoinTransByPairs.cc:341:14: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (i=0; i<dna.size(); i++) {
^
/bin/rm -f lib_JoinTransByPairs_temp.a
ar -qc lib_JoinTransByPairs_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/JoinTransByPairs.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./JoinTransByPairs
g++ -ggdb3 -fopenmp -o ./JoinTransByPairs obj/analysis/JoinTransByPairs.o -L. -lm -pthread -l_JoinTransByPairs_temp
/bin/rm lib_JoinTransByPairs_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:00 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/QuantifyGraph.cc -o obj/analysis/QuantifyGraph.o
/bin/rm -f lib_QuantifyGraph_temp.a
ar -qc lib_QuantifyGraph_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/QuantifyGraph.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./QuantifyGraph
g++ -ggdb3 -fopenmp -o ./QuantifyGraph obj/analysis/QuantifyGraph.o -L. -lm -pthread -l_QuantifyGraph_temp
/bin/rm lib_QuantifyGraph_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:03 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/ReadsToTranscripts.cc -o obj/analysis/ReadsToTranscripts.o
/bin/rm -f lib_ReadsToTranscripts_temp.a
ar -qc lib_ReadsToTranscripts_temp.a obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/analysis/ReadsToTranscripts.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./ReadsToTranscripts
g++ -ggdb3 -fopenmp -o ./ReadsToTranscripts obj/analysis/ReadsToTranscripts.o -L. -lm -pthread -l_ReadsToTranscripts_temp
/bin/rm lib_ReadsToTranscripts_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:09 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./ReadsToTranscripts_MPI.cc -o obj/ReadsToTranscripts_MPI.o
/bin/rm -f lib_ReadsToTranscripts_MPI_temp.a
ar -qc lib_ReadsToTranscripts_MPI_temp.a obj/ReadsToTranscripts_MPI.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./ReadsToTranscripts_MPI
g++ -ggdb3 -fopenmp -o ./ReadsToTranscripts_MPI obj/ReadsToTranscripts_MPI.o -L. -lm -pthread -l_ReadsToTranscripts_MPI_temp
/bin/rm lib_ReadsToTranscripts_MPI_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:14 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./ReadsToTranscripts_MPI_chang.cc -o obj/ReadsToTranscripts_MPI_chang.o
/bin/rm -f lib_ReadsToTranscripts_MPI_chang_temp.a
ar -qc lib_ReadsToTranscripts_MPI_chang_temp.a obj/ReadsToTranscripts_MPI_chang.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/NonRedKmerTable.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./ReadsToTranscripts_MPI_chang
g++ -ggdb3 -fopenmp -o ./ReadsToTranscripts_MPI_chang obj/ReadsToTranscripts_MPI_chang.o -L. -lm -pthread -l_ReadsToTranscripts_MPI_chang_temp
/bin/rm lib_ReadsToTranscripts_MPI_chang_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:18 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/RunButterfly.cc -o obj/analysis/RunButterfly.o
./analysis/RunButterfly.cc: In member function ‘void JobControl::ClearFiles()’:
./analysis/RunButterfly.cc:107:25: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]
system(rm.c_str());
^
./analysis/RunButterfly.cc: In member function ‘void JobControl::Submit()’:
./analysis/RunButterfly.cc:77:27: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]
system(theCmmd.c_str());
^
./analysis/RunButterfly.cc:85:27: warning: ignoring return value of ‘int system(const char*)’, declared with attribute warn_unused_result [-Wunused-result]
system(theCmmd.c_str());
^
/bin/rm -f lib_RunButterfly_temp.a
ar -qc lib_RunButterfly_temp.a obj/analysis/RunButterfly.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./RunButterfly
g++ -ggdb3 -fopenmp -o ./RunButterfly obj/analysis/RunButterfly.o -L. -lm -pthread -l_RunButterfly_temp
/bin/rm lib_RunButterfly_temp.a
g++ -W -Wall -Wno-unused -Wno-deprecated -ansi -pedantic -Wno-long-long -fno-nonansi-builtins -Wctor-dtor-privacy -Wsign-promo -Woverloaded-virtual -Wendif-labels -O3 -ggdb3 -DMAKE_DATE='"Die Jul 3 11:28:23 CEST 2018 "' -DMAKE_OS_RELEASE='"4.4.0-128-generic"' -DMAKE_RELEASE='"3.0"' -DNEW_MAKEFILE -imacros system/BigFileDefines.h -pthread -ftemplate-depth-30 -fno-strict-aliasing -mieee-fp -iquote . -ISpines -fopenmp -c ./analysis/TranscriptomeFromVaryK.cc -o obj/analysis/TranscriptomeFromVaryK.o
./analysis/TranscriptomeFromVaryK.cc: In function ‘int main(int, char**)’:
./analysis/TranscriptomeFromVaryK.cc:216:16: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (j=0; j<=d.lsize()-k; j++) {
^
./analysis/TranscriptomeFromVaryK.cc:218:22: warning: comparison between signed and unsigned integer expressions [-Wsign-compare]
for (int x=j; x<j+k; x++) {
^
/bin/rm -f lib_TranscriptomeFromVaryK_temp.a
ar -qc lib_TranscriptomeFromVaryK_temp.a obj/aligns/KmerAlignCore.o obj/analysis/AACodons.o obj/analysis/DNAVector.o obj/analysis/KmerTable.o obj/analysis/NonRedKmerTable.o obj/analysis/TranscriptomeFromVaryK.o obj/base/ErrorHandling.o obj/base/FileParser.o obj/base/StringUtil.o obj/util/mutil.o
./checkLock ./TranscriptomeFromVaryK
g++ -ggdb3 -fopenmp -o ./TranscriptomeFromVaryK obj/analysis/TranscriptomeFromVaryK.o -L. -lm -pthread -l_TranscriptomeFromVaryK_temp
/bin/rm lib_TranscriptomeFromVaryK_temp.a
make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/Chrysalis'
cd trinity-plugins && make trinity_essentials
make[1]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins'
tar xvf seqtk-trinity.v0.0.2.tar.gz
seqtk-trinity-0.0.2/
seqtk-trinity-0.0.2/.gitignore
seqtk-trinity-0.0.2/LICENSE
seqtk-trinity-0.0.2/Makefile
seqtk-trinity-0.0.2/README.md
seqtk-trinity-0.0.2/khash.h
seqtk-trinity-0.0.2/kseq.h
seqtk-trinity-0.0.2/seqtk.c
seqtk-trinity-0.0.2/testing/
seqtk-trinity-0.0.2/testing/newformat_1.fq
seqtk-trinity-0.0.2/testing/newformat_2.fq
seqtk-trinity-0.0.2/testing/oldformat_1.fq
seqtk-trinity-0.0.2/testing/oldformat_2.fq
cd seqtk-trinity-0.0.2 && make
make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/seqtk-trinity-0.0.2'
gcc -g -Wall -O2 -Wno-unused-function seqtk.c -o seqtk-trinity -lz -lm
seqtk.c: In function ‘stk_comp’:
seqtk.c:444:16: warning: variable ‘lc’ set but not used [-Wunused-but-set-variable]
int la, lb, lc, na, nb, nc, cnt[11];
^
make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/seqtk-trinity-0.0.2'
mv seqtk-trinity-0.0.2/seqtk-trinity ./BIN/.
tar -zxvf "ParaFly-0.1.0".tar.gz && \
cd "ParaFly-0.1.0" && sh ./configure --prefix=`pwd` && make install && \
cp bin/ParaFly ../BIN/
ParaFly-0.1.0/
ParaFly-0.1.0/LICENSE
ParaFly-0.1.0/Makefile
ParaFly-0.1.0/Makefile.am
ParaFly-0.1.0/Makefile.in
ParaFly-0.1.0/README.md
ParaFly-0.1.0/aclocal.m4
ParaFly-0.1.0/bin/
ParaFly-0.1.0/bin/ParaFly
ParaFly-0.1.0/config.h
ParaFly-0.1.0/config.h.in
ParaFly-0.1.0/config.log
ParaFly-0.1.0/config.status
ParaFly-0.1.0/configure
ParaFly-0.1.0/configure.ac
ParaFly-0.1.0/depcomp
ParaFly-0.1.0/install-sh
ParaFly-0.1.0/missing
ParaFly-0.1.0/src/
ParaFly-0.1.0/src/.deps/
ParaFly-0.1.0/src/.deps/ParaFly.Po
ParaFly-0.1.0/src/.deps/argProcessor.Po
ParaFly-0.1.0/src/Makefile
ParaFly-0.1.0/src/Makefile.am
ParaFly-0.1.0/src/Makefile.in
ParaFly-0.1.0/src/ParaFly.cpp
ParaFly-0.1.0/src/argProcessor.cpp
ParaFly-0.1.0/src/argProcessor.hpp
ParaFly-0.1.0/stamp-h1
ParaFly-0.1.0/test/
ParaFly-0.1.0/test/Makefile
ParaFly-0.1.0/test/cmds.txt
ParaFly-0.1.0/test/rand_exit.pl
checking for a BSD-compatible install... /usr/bin/install -c
checking whether build environment is sane... yes
checking for a thread-safe mkdir -p... /bin/mkdir -p
checking for gawk... gawk
checking whether make sets $(MAKE)... yes
checking for g++... g++
checking for C++ compiler default output file name... a.out
checking whether the C++ compiler works... yes
checking whether we are cross compiling... no
checking for suffix of executables...
checking for suffix of object files... o
checking whether we are using the GNU C++ compiler... yes
checking whether g++ accepts -g... yes
checking for style of include used by make... GNU
checking dependency style of g++... gcc3
checking for library containing cos... none required
configure: creating ./config.status
config.status: creating Makefile
config.status: creating src/Makefile
config.status: creating config.h
config.status: config.h is unchanged
config.status: executing depfiles commands
make[2]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
Making install in src
make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'
g++ -DHAVE_CONFIG_H -I. -I.. -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2 -MT ParaFly.o -MD -MP -MF .deps/ParaFly.Tpo -c -o ParaFly.o ParaFly.cpp
mv -f .deps/ParaFly.Tpo .deps/ParaFly.Po
g++ -DHAVE_CONFIG_H -I. -I.. -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2 -MT argProcessor.o -MD -MP -MF .deps/argProcessor.Tpo -c -o argProcessor.o argProcessor.cpp
mv -f .deps/argProcessor.Tpo .deps/argProcessor.Po
g++ -pedantic -fopenmp -Wall -Wextra -Wno-long-long -Wno-deprecated -m64 -g -O2 -o ParaFly ParaFly.o argProcessor.o
make[4]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'
test -z "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin" || /bin/mkdir -p "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin"
/usr/bin/install -c ParaFly '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/bin'
make[4]: Nothing to be done for 'install-data-am'.
make[4]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'
make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0/src'
make[3]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
make[4]: Entering directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
make[4]: Nothing to be done for 'install-exec-am'.
make[4]: Nothing to be done for 'install-data-am'.
make[4]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
make[3]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
make[2]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins/ParaFly-0.1.0'
ln -sf Trimmomatic-0.36 Trimmomatic
make[1]: Leaving directory '/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity-plugins'
sh ./util/support_scripts/trinity_install_tests.sh
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Performing Unit Tests of Build

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Inchworm: has been Installed Properly
Chrysalis: has been Installed Properly
QuantifyGraph: has been Installed Properly
GraphFromFasta: has been Installed Properly
ReadsToTranscripts: has been Installed Properly
parafly: has been Installed Properly
➜ trinityrnaseq-Trinity-v2.6.6 git:(master) ✗
➜ trinityrnaseq-Trinity-v2.6.6 git:(master) ✗ ./Trinity

###############################################################################
#

______ ____ ____ ____ ____ ______ __ __
| || \ | || \ | || || | |
| || D ) | | | _ | | | | || | |
|_| |_|| / | | | | | | | |_| |_|| ~ |
| | | \ | | | | | | | | | |___, |
| | | . \ | | | | | | | | | | |
|__| |__|\_||____||__|__||____| |__| |____/

#
#
# Required:
#
# --seqType <string> :type of reads: ('fa' or 'fq')
#
# --max_memory :suggested max memory to use by Trinity where limiting can be enabled. (jellyfish, sorting, etc)
# provided in Gb of RAM, ie. '--max_memory 10G'
#
# If paired reads:
# --left :left reads, one or more file names (separated by commas, no spaces)
# --right :right reads, one or more file names (separated by commas, no spaces)
#
# Or, if unpaired reads:
# --single :single reads, one or more file names, comma-delimited (note, if single file contains pairs, can use flag: --run_as_paired )
#
# Or,
# --samples_file tab-delimited text file indicating biological replicate relationships.
# ex.
# cond_A cond_A_rep1 A_rep1_left.fq A_rep1_right.fq
# cond_A cond_A_rep2 A_rep2_left.fq A_rep2_right.fq
# cond_B cond_B_rep1 B_rep1_left.fq B_rep1_right.fq
# cond_B cond_B_rep2 B_rep2_left.fq B_rep2_right.fq
#
# # if single-end instead of paired-end, then leave the 4th column above empty.
#
####################################
## Misc: #########################
#
# --SS_lib_type :Strand-specific RNA-Seq read orientation.
# if paired: RF or FR,
# if single: F or R. (dUTP method = RF)
# See web documentation.
#
# --CPU :number of CPUs to use, default: 2
# --min_contig_length :minimum assembled contig length to report
# (def=200)
#
# --long_reads :fasta file containing error-corrected or circular consensus (CCS) pac bio reads
# (** note: experimental parameter **, this functionality continues to be under development)
#
# --genome_guided_bam :genome guided mode, provide path to coordinate-sorted bam file.
# (see genome-guided param section under --show_full_usage_info)
#
# --jaccard_clip :option, set if you have paired reads and
# you expect high gene density with UTR
# overlap (use FASTQ input file format
# for reads).
# (note: jaccard_clip is an expensive
# operation, so avoid using it unless
# necessary due to finding excessive fusion
# transcripts w/o it.)
#
# --trimmomatic :run Trimmomatic to quality trim reads
# see '--quality_trimming_params' under full usage info for tailored settings.
#
#
# --no_normalize_reads :Do *not* run in silico normalization of reads. Defaults to max. read coverage of 50.
# see '--normalize_max_read_cov' under full usage info for tailored settings.
# (note, as of Sept 21, 2016, normalization is on by default)
#
# --no_distributed_trinity_exec :do not run Trinity phase 2 (assembly of partitioned reads), and stop after generating command list.
#
#
# --output :name of directory for output (will be
# created if it doesn't already exist)
# default( your current working directory: "/home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/trinity_out_dir"
# note: must include 'trinity' in the name as a safety precaution! )
#
# --workdir :where Trinity phase-2 assembly computation takes place (defaults to --output setting).
# (can set this to a node-local drive or RAM disk)
#
# --full_cleanup :only retain the Trinity fasta file, rename as ${output_dir}.Trinity.fasta
#
# --cite :show the Trinity literature citation
#
# --verbose :provide additional job status info during the run.
#
# --version :reports Trinity version (Trinity-v2.6.6) and exits.
#
# --show_full_usage_info :show the many many more options available for running Trinity (expert usage).
#
#
###############################################################################
#
# *Note, a typical Trinity command might be:
#
# Trinity --seqType fq --max_memory 50G --left reads_1.fq --right reads_2.fq --CPU 6
#
#
# and for Genome-guided Trinity:
#
# Trinity --genome_guided_bam rnaseq_alignments.csorted.bam --max_memory 50G
# --genome_guided_max_intron 10000 --CPU 6
#
# see: /home/urbe/Tools/trinityrnaseq-Trinity-v2.6.6/sample_data/test_Trinity_Assembly/
# for sample data and 'runMe.sh' for example Trinity execution
#
# For more details, visit: http://trinityrnaseq.github.io
#
###############################################################################

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

This course is organized with support from the IAP “Belgian Medical Genomics Initiative”, SymBioSys and the Genomics Core.

For inquiries, please email Ms Narcisse Opdekamp ( narcisse.opdekamp@uzleuven.be ).

More at >> http://gc.uzleuven.be/

Next generation quantitative genetics in plants. Jiménez-Gómez, Frontiers in Plant Science 2:77, 2011 Full Text [equally relevant to animal and microbial systems]

Sense from sequence reads: methods for alignment and assembly. Flicek & Birney, Nat Methods 6(11 Suppl):S6-S12, 2009. Full Text

Library construction and experimental design

Statistical design and analysis of RNA sequencing data. Auer & Doerge, Genetics 185(2):405-16, 2010. PubMedCentral

Biases in Illumina transcriptome sequencing caused by random hexamer priming. Hansen et al., Nucleic Acids Res. 38(12): e131, 2010. PubMedCentral

Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries. Aird et al, Genome Biology 12:R18, 2011 Full Text

Amplification-free Illumina sequencing-library preparation facilitates improved mapping and assembly of GC-biased genomes. Kozarewa et al, Nature Methods 6(4):291-5, 2009 PubMedCentral

Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Rohland & Reich, Genome Research 22(5): 939–946. PubMedCentral

Data formats, data management, and alignment software tools

The Sequence Alignment/Map format and SAMtools. Li et al, Bioinformatics 25(16):2078-9, 2009 PubMedCentral

SAM format specification file

Efficient storage of high throughput sequencing data using reference-based compression. Fritz et al, Genome Res 21(5):734-40, 2011. Full Text

Compression of DNA sequence reads in FASTQ format. Deorowicz & Grabowski, Bioinformatics 27(6):860-2, 2011. PubMed

Fast and accurate short read alignment with Burrows-Wheeler transform. Li & Durbin, Bioinformatics 25(14):1754-60, 2009. PubMedCentral

Improving SNP discovery by base alignment quality. Li H, Bioinformatics 27(8):1157-8, 2011. PubMed

BEDTools: a flexible suite of utilities for comparing genomic features. Quinlan and Hall, Bioinformatics 26:841-842, 2010. Publisher Website

Data quality assessment, filtering, and correction

SolexaQA: At-a-glance quality assessment of Illumina second-generation sequencing data. Cox et al, BMC Bioinformatics 11:485, 2010. PubMedCentral

TileQC: a system for tile-based quality control of Solexa data. Dolan & Denver, BMC Bioinformatics 9:250, 2008 PubMedCentral [requires a reference sequence]

Quake: quality-aware detection and correction of sequencing errors. Kelley et al, Genome Biol 11(11):R116, 2010. PubMed

FastQC: a quality control tool for high-throughput sequence data. Home Page

FASTX-toolkit: FASTQ/A short-reads pre-processing tools Home Page

Reference-free validation of short read data. Schröder et al, PLoS One 5(9):e12681, 2010. PubMedCentral

Correction of sequencing errors in a mixed set of reads. Salmela, Bioinformatics 26(10):1284, 2010. Full Text [includes error correction of SOLiD reads in colorspace]

Repeat-aware modeling and correction of short read errors. Yang et al, BMC Bioinformatics 12(Supp1):S52, 2011 PubMedCentral [requires a reference sequence]

HiTEC: accurate error correction in high-throughput sequencing data. Ilie et al, Bioinformatics 27(3):295, 2011 Full Text

Error correction of high-throughput sequencing datasets with non-uniform coverage. Medvedev et al., Bioinformatics 27(13):i137-41, 2011. PubMedCentral

De novo assembly

Velvet: algorithms for de novo short read assembly using de Bruijn graphs. Zerbino & Birney, Genome Res 18(5):821-9, 2008. u>PubMedCentral

Assembly of large genomes using second-generation sequencing. Schatz et al, Genome Res 20(9):1165-73, 2010. PubMedCentral

High-quality draft assemblies of mammalian genomes from massively parallel sequence data. Gnerre et al, PNAS 108(4): 1513-18, 2011 PubMedCentral

Genome assembly has a major impact on gene content: a comparison of annotation in two Bos taurus assemblies. Florea  et al., PLoS One 6(6):e21400, 2011. PubMedCentral

Artemis: an integrated platform for visualization and analysis of high-throughput sequence-based experimental data. Carver et al, Bioinformatics 28(4):464 - 469, 2012 PubMedCentral

Efficient de novo assembly of large genomes using compressed data structures. Simpson & Durbin, Genome Research 22:549-556, 2012 Full Text [Describes the String Graph Assembler (SGA), which assembled a human genome in less than 6 days using 54 Gb of RAM and a 123-processor compute cluster for calculation of an FM-index of the 1.2 billion reads]

Readjoiner: a fast and memory efficient string graph-based sequence assembler. Gonnella & Kurtz, BMC Bioinformatics 13: 82, 2012 PubMedCentral

Assemblathon 1: A competitive assessment of de novo short read assembly methods. Earl et al, Genome Research 21:2224-2241, 2011 Full Text

Chromatin immunoprecipation analysis: ChIP-seq

ChIP-seq: advantages and challenges of a maturing technology. Park, Nat Rev Genet. 10:669-80, 2009 PubMed

ChIP-seq and Beyond: new and improved methodologies to detect and characterize protein-DNA interactions. Furey, Nat Rev Genet 13: 840–852, 2012 Publisher Web Site

MuMoD: a Bayesian approach to detect multiple modes of protein–DNA binding from genome-wide ChIP data. Narlikar, Nucleic Acids Res 41:21–32, 2013 PubMed

Transcriptome analysis

Assembly and comparison to genome

Full-length transcriptome assembly from RNA-Seq data without a reference genome. Grabherr et al, Nature Biotechnology 29:644 - 652, 2011. PubMed [The software is called Trinity, and is available on Sourceforge.]

Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome. Peng et al, Nature Biotechnology 30:253 - 260, 2012. PubMed [Several comments on this paper question whether the reported differences are in fact evidence of editing or are simply sequencing errors - the authors stand by their conclusions, but the controversy demonstrates the importance of robust data analysis methods.]

Optimization of de novo transcriptome assembly from next-generation sequencing data. Surget-Groba & Montoya-Burgos, Genome Res 20(10):1432-40, 2010. Full Text

Rnnotator: an automated de novo transcriptome assembly pipeline from stranded RNA-Seq reads. Martin et al, BMC Genomics 11:663, 2010 Full Text

De novo assembly and analysis of RNA-seq data. Robertson et al, Nature Methods 7:909-912, 2010 Full Text [describes Trans-ABySS, a pipeline to use the ABySS parallel assembler for de novo transcriptome analysis]

Differential expression analysis

R-SAP: a multi-threading computational pipeline for the characterization of high-throughput RNA-sequencing data. Mittal & McDonald, Nucleic Acids Res, 2012 Full Text

Targeted RNA sequencing reveals the deep complexity of the human transcriptome. Mercer et al, Nature Biotechnology 30:99 - 104, 2012 Publisher Website

Differential gene and transcript expression analysis of RNA-Seq experiments with TopHat and Cufflinks. Trapnell et al, Nature Protocols 7:562 - 578, 2012 Publisher Website

Characterization and improvement of RNA-Seq precision in quantitative transcript expression profiling. Łabaj et al, Bioinformatics 27:i383 - i391, 2011 Full Text

Improving RNA-Seq expression estimates by correcting for fragment bias. Roberts et al, Genome Biol 12:R22, 2011 PubMed Central

Cloud-scale RNA-sequencing differential expression analysis with Myrna. Langmead et al, Genome Biol 11:R83, 2010 Full Text

From RNA-seq reads to differential expression results. Oshlack et al, Genome Biol 11(12):220, 2010 Full Text

DEGseq: an R package for identifying differentially expressed genes from RNA-seq data. Wang et al., Bioinformatics. 26(1):136-8. 2010 PubMed

DEseq: Differential expression analysis for sequence count data. Anders and Huber, Genome Biology 11:R106, 2010 Full Text

edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Robinson et al., Bioinformatics 26(1):139-40 2010 PubMedCentral

Two-stage Poisson model for testing RNA-seq data. Auer and Doerge, SAGMB 10(1), article 26 Full Text

Experimental design, preprocessing, normalization and differential expression analysis of small RNA sequencing experiments. McCormick et al., Silence2(1):2, 2011 PubMedCentral

RNA-Seq gene expression estimation with read mapping uncertainty. Li et al, Bioinformatics 26:493-500, 2010 PubMedCentral [describes the RSEM software package]

Comparing genomes and assemblies; variant detection

Versatile and open software for comparing large genomes. Kurtz et al, Genome Biol (5(2):R12, 2004. PubMedCentral [describes the MUMmer software for full-genome alignment & comparisons]

Searching for SNPs with cloud computing. Langmead et al, Genome Biol 10(11):R134, 2009 Full Text

Calling SNPs without a reference sequence. Ratan et al, BMC Bioinformatics 11:130, 2010 PubMedCentral

Microindel detection in short-read sequence data. Krawitz et al, Bioinformatics 26(6):722-9, 2010. Full Text

vipR: variant identification in pooled DNA using R. Altmann et al., Bioinformatics 27: i77-i84, 2011. PubMedCentral

Geoseq: a tool for dissecting deep-sequencing datasets. Gurtowski et al, BMC Bioinformatics 11:506, 2010. PubMedCentral [Geoseq is a web service that allows searching deep sequencing datasets with a reference sequence of a gene of interest]

Detecting and annotating genetic variations using the HugeSeq pipeline. Lam et al, Nature Biotechnology 30:226 - 229, 2012 Publisher Website, Home Page

Genome-wide LORE1 retrotransposon mutagenesis and high-throughput insertion detection in Lotus japonicus. Urbański et al, Plant J 64:731-741, 2012. Publisher Website [This paper describes a 2-dimensional pooling strategy with barcoding to allow use of Illumina sequencing to screen for retrotransposon insertion mutations, and includes a software package called FSTpoolit for analysis of the resulting sequence reads.]

Genotyping by sequencing

Genome-wide genetic marker discovery and genotyping using next-generation sequencing. Davey et al., Nat Rev Genet 12(7):499-510, 2011 PubMed [A review of methods available at the time]

A robust, simple genotyping-by-sequencing (GBS) approach for high diversity species. Elshire et al., PLoS One 6(5):e19379, 2011. Full Text

Development of high-density genetic maps for barley and wheat using a novel two-enzyme genotyping-by-sequencing approach. Poland et al., PLoS One 7(2): e32253, 2012. Full Text

Double digest RADseq: an inexpensive method for de novo SNP discovery and genotyping in model and non-model species. Peterson et al, PLoS One 7(5):e37135, . 2012. Full Text

Imputation of unordered markers and the impact on genomic selection accuracy. Rutkowski et al, G3 3(3):427-39, 2013. Full Text

Diversity Arrays Technology (DArT) and next-generation sequencing combined: genome-wide, high-throughput, highly informative genotyping for molecular breeding of Eucalyptus. Sansaloni et al., BMC Proceedings 5(Suppl 7):P54, 2011 Full Text

High-throughput genotyping by whole-genome resequencing. Huang et al., Genome Res 19(6):1068-76, 2009. Full Text

Multiplexed shotgun genotyping for rapid and efficient genetic mapping. Andolfatto et al. Genome Res 21(4):610-7, 2011. Full Text

Restriction-site Associated DNA (RAD) markers

Rapid SNP discovery and genetic mapping using sequenced RAD markers. Baird et al, PLoS One 3(10):e3376, 2008 Full Text

Linkage mapping and comparative genomics using next-generation RAD sequencing of a non-model organism. Baxter et al., PLoS One 6(4):e19315, 2011. Full Text

Genome evolution and meiotic maps by massively parallel DNA sequencing: spotted gar, an outgroup for the teleost genome duplication. Amores et al, Genetics 188(4):799-808, 2011. PubMed

Construction and application for QTL analysis of a Restriction-site Associated DNA (RAD) linkage map in barley. Chutimanitsakun et al, BMC Genomics 4; 12:4, 2011. Full Text

RAD tag sequencing as a source of SNP markers in Cynara cardunculus L. Scaglione et al., BMC Genomics 13:3, 2012. Full Text

Paired-end RAD-seq for de novo assembly and marker design without available reference. Willing et al., Bioinformatics 27(16):2187-93, 2011. Publisher Website

Local de novo assembly of RAD paired-end contigs using short sequencing reads. Etter et al., PLOS ONE 6(4): e18561, 2011. Full Text

Stacks: building and genotyping loci de novo from short-read sequences. Catchen et al., G3: Genes, Genomes, Genetics, 1:171-182, 2011. Full Text, Home Page

Rainbow: an integrated tool for efficient clustering and assembling RAD-seq reads. Chong et al, Bioinformatics 28(21):2732-7, 2012. Publisher Website

UK RAD Sequencing Wiki page, with bibliography and RADTools software download Home Page

Workspace environments

Papers

Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences. Goecks et al, Genome Biol 11(8):R86, 2010 PubMedCentral

Galaxy Cloudman: Delivering compute clusters. BMC Bioinformatics 11(Suppl. 12):S4, 2010 Full Text

The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. McKenna et al, Genome Res 20(9):1297-303, 2010. PubMedCentral

A framework for variation discovery and genotyping using next-generation DNA sequencing data. DePristo et al., Nat Genet 43(5):491-8, 2011. PubMed

Online resources

The R statistical computing environment includes Bioconductor, a specialized set of tools for analysis of microarray and high-throughput sequencing data. Introductory materials from on-line or short workshops are widely available online; examples are Evomics2012 Bioconductor-tutorial.pdf, and Intro to Bioconductor. Materials from an advanced course on high-throughput genetic data analysis are at Seattle 2012 materials. Thomas Girke of UC-Riverside has written a very complete set of manuals describing the use of R and Bioconductor for analysis of genomic datasets, available at R and Bioconductor Manuals.
Manuals and contributed documentation for R are available at the R-project.org website, and video tutorials are also available on Youtube; those posted by Tutorlol are brief, clear, and to the point.
Materials from a series of mini-courses in R taught in 2010 at UCLA are available:

• Intro to programming and graphics
• Data manipulation and functions
• Graphics for exploratory data analysis
• Introductory statistics
• Linear regression

A Little Book of R for Bioinformatics is an on-line resource with information and exercises to provide practice in bioinformatics analysis of DNA sequences and other biological data in R.
Many books on specific topics in R programming are also available through Amazon or other vendors.

Cloud computing resources

The case for cloud computing in genome informatics. Lincoln Stein, Genome Biol. 11(5):207, 2010 Pubmed

Galaxy Cloudman: delivering cloud compute clusters. Afgan et al, BMC Bioinformatics 11(Suppl 12):S4, 2010 Full Text

CloudBioLinux is an open-source project that provides a bioinformatics Linux system for cloud computing, pre-configured with a variety of software tools installed and ready to use.

A tutorial on getting started with CloudBioLinux on the Amazon Web Services Elastic Compute Cloud (EC2)

“Deploying Galaxy on the Cloud” – slides from a presentation by Enis Afgan (Emory University) at the
 Bioinformatics Open Source Conference in Boston, July 2010

A screencast that provides a step-by-step guide to starting a Galaxy cluster in the EC2 environment

A webpage that has the same information in text form, and is the basis for the screencast

The iPlant Collaborative, an NSF-funded project to create computational resources for plant biology research, provides access to cloud computing resources through Atmosphere

SeqWare Query Engine: storing and searching sequence data in the cloud. O’Connor et al, BMC Bioinformatics 11(Suppl 12):S2, 2010 Full Text

An overview of the Hadoop/MapReduce/HBase framework and its current applications in bioinformatics. Taylor, BMC Bioinformatics 11(Suppl 12):S1, 2010 Full Text

Links to Linux command-line tutorials and resources

Tutorials for AWK, a powerful tool for handling data tables

• A set of awk notes from Boston University
• Bruce Barnett's awk tutorial
• Greg Goebel's awk tutorial
• Executing an awk command from R to simplify data exploratory analysis, from Lex Nederbragt

Tutorials for bash shell scripting

• A tutorial at linuxconfig.org
• A Getting Started With Bash tutorial at hypexr.org
• Mendel Cooper's Advanced Bash Shell-Scripting Guide

Tutorials for sed, the command-line stream editor

• A tutorial at Rutgers
• Peteris Krumins claims to have the World's Best Introduction to Sed; take a look and judge for yourself.
• Bruce Barnett's sed tutorial.

Links to other useful sites

The SEQanswers online community has forums on several topics related to sequencing; the bioinformatics forum is the most active.

The SEQanswers Software Wiki is a list of software for analysis of sequencing data

Biostar is another online community for questions and answers on bioinformatics and computational genomics.

Information on file formats used by the University of California - Santa Cruz Genome Browser is on the FAQ list

A manual for the Integrated Genome Browser visualization tool is here

Course materials for a short course entitled Introduction to R and Bioconductor, held in Seattle in Dec 2010

Genomic Regions Enrichment of Annotations Tool - A web service to test for over-representation of specific ontology categories among genes near ChIP-seq peaks

Next-gen-seq software - a list of software packages, both commercial and open-source, related to analysis of deep sequencing datasets

Software from the Center for Bioinformatics and Computational Biology, University of Maryland - many useful programs, all open-source

PLAZA: a comparative genomics resource to study gene and genome evolution in plants; described by Proost et al, Plant Cell 21:3718, 2010 Full Text

The European Bioinformatics Institute provides tools ArrayExpressHTS and R-Cloud for analysis of transcriptome data

Lab Page http://gabi.cidbio.org/index/

More at http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1000369

Address of the bookmark: http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1000369