<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/37257?offset=350</link>
	<atom:link href="https://bioinformaticsonline.com/related/37257?offset=350" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/30168/gene-synteny-database</guid>
	<pubDate>Fri, 16 Dec 2016 11:09:39 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/30168/gene-synteny-database</link>
	<title><![CDATA[Gene Synteny Database]]></title>
	<description><![CDATA[<p>Comparative genomics remains a pivotal strategy to study the evolution of gene organization, and this primacy is reinforced by the growing number of full genome sequences available in public repositories. Despite this growth, bioinformatic tools available to visualize and compare genomes and to infer evolutionary events remain restricted to two or three genomes at a time, thus limiting the breadth and the nature of the question that can be investigated. Here we present Genomicus, a new synteny browser that can represent and compare unlimited numbers of genomes in a broad phylogenetic view. In addition, Genomicus includes reconstructed ancestral gene organization, thus greatly facilitating the interpretation of the data.</p>
<p><strong>Availability:</strong>&nbsp;Genomicus is freely available for online use at&nbsp;<a href="http://www.dyogen.ens.fr/genomicus" target="pmc_ext">http://www.dyogen.ens.fr/genomicus</a>&nbsp;while data can be downloaded at&nbsp;<a href="ftp://ftp.biologie.ens.fr/pub/dyogen/genomicus" target="pmc_ext">ftp://ftp.biologie.ens.fr/pub/dyogen/genomicus</a></p>
<p><strong>Contact:</strong>&nbsp;<a href="mailto:dev@null">rf.sne.eigoloib@crh</a></p><p>Address of the bookmark: <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2853686/" rel="nofollow">https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2853686/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/30355/meme-suite</guid>
	<pubDate>Fri, 23 Dec 2016 08:49:55 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/30355/meme-suite</link>
	<title><![CDATA[MEME suite]]></title>
	<description><![CDATA[<p>Motif based sequence analysis suits&nbsp;</p>
<p>The MEME Suite allows the biologist to discover novel motifs in collections of unaligned nucleotide or protein sequences, and to perform a wide variety of other motif-based analyses.</p>
<p>The MEME Suite supports motif-based analysis of DNA, RNA and protein sequences. It provides motif discovery algorithms using both probabilistic (MEME) and discrete models (MEME), which have complementary strengths. It also allows discovery of motifs with arbitrary insertions and deletions (GLAM2). In addition to motif discovery, the MEME Suite provides tools for scanning sequences for matches to motifs (FIMO, MAST and GLAM2Scan), scanning for clusters of motifs (MCAST), comparing motifs to known motifs (Tomtom), finding preferred spacings between motifs (SpaMo), predicting the biological roles of motifs (GOMo), measuring the positional enrichment of sequences for known motifs (CentriMo), and analyzing ChIP-seq and other large datasets (MEME-ChIP).</p>
<p>The MEME Suite is comprised of a collection of tools that work together, as shown below. Not all the tools are available as webservices, so to get the full power of the MEME Suite you will need to&nbsp;<a href="http://meme-suite.org/doc/download.html">download</a>&nbsp;and&nbsp;<a href="http://meme-suite.org/doc/install.html">install</a>&nbsp;a local copy of the software. To see what has changed recently you can peruse the&nbsp;<a href="http://meme-suite.org/doc/release-notes.html">release notes</a>.</p>
<p>http://meme-suite.org/</p><p>Address of the bookmark: <a href="http://meme-suite.org/" rel="nofollow">http://meme-suite.org/</a></p>]]></description>
	<dc:creator>Bulbul</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/30833/dnasp-v5-a-software-for-comprehensive-analysis-of-dna-polymorphism-data</guid>
	<pubDate>Mon, 06 Feb 2017 04:45:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/30833/dnasp-v5-a-software-for-comprehensive-analysis-of-dna-polymorphism-data</link>
	<title><![CDATA[DnaSP v5: a software for comprehensive analysis of DNA polymorphism data]]></title>
	<description><![CDATA[<p><span>DnaSP is a software package for a comprehensive analysis of DNA polymorphism data. Version 5 implements a number of new features and analytical methods allowing extensive DNA polymorphism analyses on large datasets. Among other features, the newly implemented methods allow for: (i) analyses on multiple data files; (ii) haplotype phasing; (iii) analyses on insertion/deletion polymorphism data; (iv) visualizing sliding window results integrated with available genome annotations in the UCSC browser.</span></p><p>Address of the bookmark: <a href="http://www.ub.edu/dnasp/" rel="nofollow">http://www.ub.edu/dnasp/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/32379/enrichr-a-comprehensive-gene-set-enrichment-analysis</guid>
	<pubDate>Thu, 27 Apr 2017 05:42:09 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/32379/enrichr-a-comprehensive-gene-set-enrichment-analysis</link>
	<title><![CDATA[Enrichr: a comprehensive gene set enrichment analysis]]></title>
	<description><![CDATA[<p><span>Enrichment analysis is a popular method for analyzing gene sets generated by genome-wide experiments. Here we present a significant update to one of the tools in this domain called Enrichr. Enrichr currently contains a large collection of diverse gene set libraries available for analysis and download. In total, Enrichr currently contains 180 184 annotated gene sets from 102 gene set libraries. New features have been added to Enrichr including the ability to submit fuzzy sets, upload BED files, improved application programming interface and visualization of the results as clustergrams. Overall, Enrichr is a comprehensive resource for curated gene sets and a search engine that accumulates biological knowledge for further biological discoveries. Enrichr is freely available at:&nbsp;</span><a href="http://amp.pharm.mssm.edu/Enrichr" target="">http://amp.pharm.mssm.edu/Enrichr</a><span>.</span></p>
<p>https://academic.oup.com/nar/article-lookup/doi/10.1093/nar/gkw377</p><p>Address of the bookmark: <a href="http://amp.pharm.mssm.edu/Enrichr/" rel="nofollow">http://amp.pharm.mssm.edu/Enrichr/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34922/camsa-a-tool-for-comparative-analysis-and-merging-of-scaffold-assemblies</guid>
	<pubDate>Thu, 28 Dec 2017 09:10:26 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34922/camsa-a-tool-for-comparative-analysis-and-merging-of-scaffold-assemblies</link>
	<title><![CDATA[CAMSA :: a tool for Comparative Analysis and Merging of Scaffold Assemblies]]></title>
	<description><![CDATA[<p>CAMSA &ndash; is a tool for&nbsp;<span>C</span>omparative&nbsp;<span>A</span>nalysis and&nbsp;<span>M</span>erging of&nbsp;<span>S</span>caffold&nbsp;<span>A</span>ssemblies, distributed both as a standalone software package and as Python library under the MIT license.</p>
<p>Main features:</p>
<ol>
<li>works with any number of scaffold assemblies in de-novo non-progressive fashion</li>
<li>allows to simultaneously work with scaffold assemblies obtained from any&nbsp;<em>in silico</em>&nbsp;and&nbsp;<em>in vitro</em>&nbsp;techniques, supporting multiple existing formats via built-in converters</li>
<li>creates an extensive report with several comparative quality metrics (both on assembly level and on the level of individual assembly points)</li>
<li>constructs a merged combined scaffold assembly</li>
<li>provides an interactive framework for a visual comparative analysis of the given assemblies</li>
</ol><p>Address of the bookmark: <a href="https://cblab.org/camsa/" rel="nofollow">https://cblab.org/camsa/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39875/lrsday-long-read-sequencing-data-analysis-for-yeasts</guid>
	<pubDate>Mon, 26 Aug 2019 18:07:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39875/lrsday-long-read-sequencing-data-analysis-for-yeasts</link>
	<title><![CDATA[LRSDAY: Long-read Sequencing Data Analysis for Yeasts]]></title>
	<description><![CDATA[<p><span>Long-read sequencing technologies have become increasingly popular in genome projects due to their strengths in resolving complex genomic regions. As a leading model organism with small genome size and great biotechnological importance, the budding yeast,&nbsp;</span><em>Saccharomyces cerevisiae</em><span>, has many isolates currently being sequenced with long reads.&nbsp;</span></p><p>Address of the bookmark: <a href="https://github.com/yjx1217/LRSDAY" rel="nofollow">https://github.com/yjx1217/LRSDAY</a></p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42419/biojupies-automatically-generates-rna-seq-data-analysis-notebooks</guid>
	<pubDate>Sun, 20 Dec 2020 11:43:45 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42419/biojupies-automatically-generates-rna-seq-data-analysis-notebooks</link>
	<title><![CDATA[BioJupies: Automatically Generates RNA-seq Data Analysis Notebooks]]></title>
	<description><![CDATA[<p>With BioJupies you can produce in seconds a customized, reusable, and interactive report from your own raw or processed RNA-seq data through a simple user interface</p>
<p>BioJupies now supports user accounts! Sign in from the top right corner of the page for access to unlimited private notebooks, RNA-seq datasets and alignment jobs.</p><p>Address of the bookmark: <a href="https://amp.pharm.mssm.edu/biojupies/" rel="nofollow">https://amp.pharm.mssm.edu/biojupies/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44470/phyloherb-phylogenomic-analysis-pipeline-for-herbarium-specimens</guid>
	<pubDate>Wed, 21 Feb 2024 06:15:13 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44470/phyloherb-phylogenomic-analysis-pipeline-for-herbarium-specimens</link>
	<title><![CDATA[PhyloHerb: Phylogenomic Analysis Pipeline for Herbarium Specimens]]></title>
	<description><![CDATA[<p><span>What is PhyloHerb</span><span>: PhyloHerb is a wrapper program to process&nbsp;</span><span>genome skimming</span><span>&nbsp;data collected from plant materials. The outcomes include the plastid genome (plastome) assemblies, mitochondrial genome assemblies, nuclear ribosomal DNAs (NTS+ETS+18S+ITS1+5.8S+ITS2+28S), alignments of gene and intergenic regions, and a species tree. It is designed to be a high throughput program dealing with lower quality data. Examples include&nbsp;</span><span>low-coverage (5x cpDNA) plastome phylogeny, recycling plastid genes from target enrichment data, retrieving low-copy nuclear genes from medium coverage (5x nucDNA) genome skimming</span><span>.</span></p><p>Address of the bookmark: <a href="https://github.com/lmcai/PhyloHerb/" rel="nofollow">https://github.com/lmcai/PhyloHerb/</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</guid>
	<pubDate>Fri, 13 Dec 2024 11:41:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/44724/step-by-step-guide-to-detect-pirnas-using-bioinformatics</link>
	<title><![CDATA[Step-by-Step Guide to Detect piRNAs Using Bioinformatics]]></title>
	<description><![CDATA[<p>Piwi-interacting RNAs (piRNAs) are a class of small non-coding RNAs that play crucial roles in silencing transposable elements and regulating gene expression, particularly in germline cells. Detecting piRNAs involves identifying their unique characteristics, such as size, sequence motifs, and association with Piwi proteins, from high-throughput RNA sequencing data.</p><p>This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.</p><h4><strong>Step 1: Prepare Your Data</strong></h4><ol>
<li>
<p><strong>Obtain RNA Sequencing Data</strong><br />Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like <strong>NCBI SRA</strong>, <strong>EMBL-EBI</strong>, or specific small RNA sequencing projects.</p>
</li>
<li>
<p><strong>Quality Control (QC)</strong><br />Use <strong>FastQC</strong> to assess the quality of raw reads:</p>
<div>
<div dir="ltr"><code>fastqc reads.fastq </code></div>
</div>
<p>Evaluate the per-base quality, adapter content, and overrepresented sequences.</p>
</li>
<li>
<p><strong>Trimming and Adapter Removal</strong><br />Use tools like <strong>Cutadapt</strong> or <strong>Trim Galore!</strong> to remove adapters and low-quality bases:</p>
<div>
<div dir="ltr"><code>cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq </code></div>
</div>
<p>Ensure the remaining reads are of high quality for downstream analysis.</p>
</li>
</ol><h4><strong>Step 2: Map Reads to the Genome</strong></h4><p>Mapping reads to the reference genome is crucial for identifying piRNA loci.</p><ol>
<li>
<p><strong>Reference Genome Preparation</strong><br />Download the genome assembly of your organism from databases like <strong>Ensembl</strong>, <strong>UCSC Genome Browser</strong>, or <strong>NCBI</strong>.</p>
</li>
<li>
<p><strong>Align Reads</strong><br />Use <strong>Bowtie</strong> or <strong>STAR</strong> for small RNA alignment:</p>
<div>
<div dir="ltr"><code>bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam </code></div>
</div>
<ul>
<li><code>-v 1</code>: Allows one mismatch.</li>
<li><code>-k 1</code>: Reports the best alignment.</li>
</ul>
</li>
<li>
<p><strong>Convert SAM to BAM</strong><br />Convert and sort alignments using <strong>SAMtools</strong>:</p>
<div>
<div dir="ltr"><code>samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam </code></div>
</div>
</li>
</ol><h4><strong>Step 3: Identify Small RNAs</strong></h4><p>piRNAs are characterized by their size (24&ndash;32 nt) and strand bias.</p><ol>
<li>
<p><strong>Extract Reads by Size</strong><br />Use tools like <strong>BEDtools</strong> or custom scripts to filter reads between 24 and 32 nt:</p>
<div>
<div dir="ltr"><code>bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq &gt; piRNA_size_reads.fastq </code></div>
</div>
</li>
<li>
<p><strong>Check for Sequence Bias</strong><br />piRNAs often have a strong bias for a uridine at the 5&rsquo; end (1U bias). Use tools like <strong>WebLogo</strong> to visualize sequence motifs.</p>
</li>
</ol><h4><strong>Step 4: Detect Ping-Pong Signature</strong></h4><p>The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.</p><ol>
<li>
<p><strong>Generate Overlap Statistics</strong><br />Use the <strong>piPipes</strong> tool or custom scripts to calculate overlap:</p>
<div>
<div dir="ltr"><code>python ping_pong_overlap.py sorted_reads.bam </code></div>
</div>
</li>
<li>
<p><strong>Visualize Overlap Distribution</strong><br />Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.</p>
</li>
</ol><h4><strong>Step 5: Annotate piRNA Clusters</strong></h4><p>piRNAs are often generated from genomic clusters.</p><ol>
<li>
<p><strong>Cluster Identification</strong><br />Use tools like <strong>proTRAC</strong> or <strong>PIRANHA</strong> to identify piRNA-producing clusters:</p>
<div>
<div dir="ltr"><code>proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters </code></div>
</div>
</li>
<li>
<p><strong>Annotate Genomic Regions</strong><br />Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like <strong>BEDtools intersect</strong> can help associate piRNA clusters with genes or transposable elements:</p>
<div>
<div dir="ltr"><code>bedtools intersect -a clusters.bed -b genome_annotation.gtf &gt; annotated_clusters.bed </code></div>
</div>
</li>
</ol><h4><strong>Step 6: Functional Analysis</strong></h4><p>Functional analysis of piRNAs can uncover their targets and regulatory roles.</p><ol>
<li>
<p><strong>Predict piRNA Targets</strong><br />Use tools like <strong>IntaRNA</strong> or <strong>RNAhybrid</strong> to predict interactions between piRNAs and potential target mRNAs:</p>
<div>
<div dir="ltr"><code>RNAhybrid -t target_transcripts.fa -q piRNAs.fa &gt; piRNA_targets.txt </code></div>
</div>
</li>
<li>
<p><strong>Enrichment Analysis</strong><br />Perform GO or KEGG enrichment analysis of target genes using tools like <strong>g:Profiler</strong> or <strong>DAVID</strong>.</p>
</li>
</ol><h4><strong>Step 7: Validation and Visualization</strong></h4><ol>
<li>
<p><strong>Validate piRNA Candidates</strong><br />Cross-check the identified piRNAs against known piRNA databases, such as <strong>piRBase</strong> or <strong>piRNAdb</strong>.</p>
</li>
<li>
<p><strong>Visualize Results</strong></p>
<ul>
<li>Use <strong>IGV</strong> (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.</li>
<li>Generate heatmaps or circos plots to present piRNA distributions.</li>
</ul>
</li>
</ol><h4><strong>Step 8: Share and Publish Findings</strong></h4><ol>
<li>
<p><strong>Archive Data</strong><br />Submit sequencing data to public repositories like <strong>SRA</strong> or <strong>GEO</strong> with metadata specifying piRNA-related experiments.</p>
</li>
<li>
<p><strong>Publish Results</strong><br />Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.</p>
</li>
</ol><h4><strong>Conclusion</strong></h4><p>Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.</p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35920/mesquite-a-modular-system-for-evolutionary-analysis</guid>
	<pubDate>Tue, 13 Mar 2018 06:54:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35920/mesquite-a-modular-system-for-evolutionary-analysis</link>
	<title><![CDATA[Mesquite: A modular system for evolutionary analysis]]></title>
	<description><![CDATA[<p><span>Mesquite is modular, extendible software for evolutionary biology, designed to help biologists organize and analyze comparative data about organisms. Its emphasis is on phylogenetic analysis, but some of its modules concern population genetics, while others do non-phylogenetic multivariate analysis. Because it is modular, the analyses available depend on the modules installed.</span></p>
<p><span>https://github.com/MesquiteProject/MesquiteCore</span></p><p>Address of the bookmark: <a href="http://mesquiteproject.org/" rel="nofollow">http://mesquiteproject.org/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

</channel>
</rss>