<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/37545?offset=40</link>
	<atom:link href="https://bioinformaticsonline.com/related/37545?offset=40" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/35923/basic-command-line-to-run-blast</guid>
	<pubDate>Wed, 14 Mar 2018 05:10:34 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/35923/basic-command-line-to-run-blast</link>
	<title><![CDATA[Basic command-line to run BLAST]]></title>
	<description><![CDATA[<p>&nbsp;</p><p>The goal of this tutorial is to run you through a demonstration of the command line, which you may not have seen or used much before.</p><p>All of the commands below can copy/pasted.</p><div id="install-software"><h2>Install software<a href="http://angus.readthedocs.io/en/2016/running-command-line-blast.html#install-software" title="Permalink to this headline"></a></h2><p>Copy and paste the following commands</p><div><div><pre>sudo apt-get update &amp;&amp; sudo apt-get -y install python ncbi-blast+
</pre></div></div><p>This updates the software list and installs the Python programming language and NCBI BLAST+.</p></div><div id="get-data"><h2>Get Data<a href="http://angus.readthedocs.io/en/2016/running-command-line-blast.html#get-data" title="Permalink to this headline"></a></h2><p>Grab some data to play with. Grab some cow and human RefSeq proteins:</p><div><div><pre>wget ftp://ftp.ncbi.nih.gov/refseq/B_taurus/mRNA_Prot/cow.1.protein.faa.gz
wget ftp://ftp.ncbi.nih.gov/refseq/H_sapiens/mRNA_Prot/human.1.protein.faa.gz
</pre></div></div><p>This is only the first part of the human and cow protein files - there are 24 files total for human.</p><p>The database files are both gzipped, so lets unzip them</p><div><div><pre>gunzip *gz
ls
</pre></div></div><p>Take a look at the head of each file:</p><div><div><pre>head cow.1.protein.faa
head human.1.protein.faa
</pre></div></div><p>These are protein sequences in FASTA format. FASTA format is something many of you have probably seen in one form or another &ndash; it&rsquo;s pretty ubiquitous. It&rsquo;s just a text file, containing records; each record starts with a line beginning with a &lsquo;&gt;&rsquo;, and then contains one or more lines of sequence text.</p><p>Note that the files are in fasta format, even though they end if &rdquo;.faa&rdquo; instead of the usual &rdquo;.fasta&rdquo;. This NCBI&rsquo;s way of denoting that this is a fasta file with amino acids instead of nucleotides.</p><p>How many sequences are in each one?</p><div><div><pre>grep -c '^&gt;' cow.1.protein.faa
grep -c '^&gt;' human.1.protein.faa
</pre></div></div><p>This grep command uses the c flag, which reports a count of lines with match to the pattern. In this case, the pattern is a regular expression, meaning match only lines that begin with a &gt;.</p><p>This is a bit too big, lets take a smaller set for practice. Lets take the first two sequences of the cow proteins, which we can see are on the first 6 lines</p><div><div><pre>head -6 cow.1.protein.faa &gt; cow.small.faa
</pre></div></div></div><div id="blast"><h2>BLAST<a href="http://angus.readthedocs.io/en/2016/running-command-line-blast.html#blast" title="Permalink to this headline"></a></h2><p>Now we can blast these two cow sequences against the set of human sequences. First, we need to tell blast about our database. BLAST needs to do some pre-work on the database file prior to searching. This helps to make the software work a lot faster. Because you installed your own version of the sotware, you need to tell the shell where the software is located. Use the full path and the makeblastdb command:</p><div><div><pre>makeblastdb -in human.1.protein.faa -dbtype prot
ls
</pre></div></div><p>Note that this makes a lot of extra files, with the same name as the database plus new extensions (.pin, .psq, etc). To make blast work, these files, called index files, must be in the same directory as the fasta file.</p><p><br /> blastp [-h] [-help] [-import_search_strategy filename]<br /> [-export_search_strategy filename] [-task task_name] [-db database_name]<br /> [-dbsize num_letters] [-gilist filename] [-seqidlist filename]<br /> [-negative_gilist filename] [-negative_seqidlist filename]<br /> [-entrez_query entrez_query] [-db_soft_mask filtering_algorithm]<br /> [-db_hard_mask filtering_algorithm] [-subject subject_input_file]<br /> [-subject_loc range] [-query input_file] [-out output_file]<br /> [-evalue evalue] [-word_size int_value] [-gapopen open_penalty]<br /> [-gapextend extend_penalty] [-qcov_hsp_perc float_value]<br /> [-max_hsps int_value] [-xdrop_ungap float_value] [-xdrop_gap float_value]<br /> [-xdrop_gap_final float_value] [-searchsp int_value]<br /> [-sum_stats bool_value] [-seg SEG_options] [-soft_masking soft_masking]<br /> [-matrix matrix_name] [-threshold float_value] [-culling_limit int_value]<br /> [-best_hit_overhang float_value] [-best_hit_score_edge float_value]<br /> [-window_size int_value] [-lcase_masking] [-query_loc range]<br /> [-parse_deflines] [-outfmt format] [-show_gis]<br /> [-num_descriptions int_value] [-num_alignments int_value]<br /> [-line_length line_length] [-html] [-max_target_seqs num_sequences]<br /> [-num_threads int_value] [-ungapped] [-remote] [-comp_based_stats compo]<br /> [-use_sw_tback] [-version]</p><p>Now we can run the blast job. We will use blastp, which is appropriate for protein to protein comparisons.</p><div><div><pre>blastp -query cow.small.faa -db human.1.protein.faa
</pre></div></div><p>This gives us a lot of information on the terminal screen. But this is difficult to save and use later - Blast also gives the option of saving the text to a file.</p><div><div><pre>    blastp -query cow.small.faa -db human.1.protein.faa -out cow_vs_human_blast_results.txt
ls
</pre></div></div><p>Take a look at the results using less. Note that there can be more than one match between the query and the same subject. These are referred to as high-scoring segment pairs (HSPs).</p><div><div><pre>less cow_vs_human_blast_results.txt
</pre></div></div><p>So how do you know about all the options, such as the flag to create an output file? Lets also take a look at the help pages. Unfortunately there are no man pages (those are usually reserved for shell commands, but some software authors will provide them as well), but there is a text help output</p><div><div><pre>blastp -help
</pre></div></div><p>To scroll through slowly</p><div><div><pre>blastp -help | less
</pre></div></div><p>To quit the less screen, press the q key.</p><p>Parameters of interest include the -evalue (Default is 10?!?) and the -outfmt</p><p>Lets filter for more statistically significant matches with a different output format:</p><div><div><pre>blastp \
-query cow.small.faa \
-db human.1.protein.faa \
-out cow_vs_human_blast_results.tab \
-evalue 1e-5 \
-outfmt 7
</pre></div></div><p>I broke the long single command into many lines with by &ldquo;escaping&rdquo; the newline. That forward slash tells the command line &ldquo;Wait, I&rsquo;m not done yet!&rdquo;. So it waits for the next line of the command before executing.</p><p>Check out the results with less.</p><p>Lets try a medium sized data set next</p><div><div><pre>head -199 cow.1.protein.faa &gt; cow.medium.faa
</pre></div></div><p>What size is this db?</p><div><div><pre>grep -c '^&gt;' cow.medium.faa
</pre></div></div><p>Lets run the blast again, but this time lets return only the best hit for each query.</p><div><div><pre>blastp \
-query cow.medium.faa \
-db human.1.protein.faa \
-out cow_vs_human_blast_results.tab \
-evalue 1e-5 \
-outfmt 6 \
-max_target_seqs 1
</pre></div></div></div><div id="summary"><h2>Summary<a href="http://angus.readthedocs.io/en/2016/running-command-line-blast.html#summary" title="Permalink to this headline"></a></h2><p>Review:</p><ul>
<li>command line programs such as blast use flags to get information about how and what to do</li>
<li>blast options can be found by typing&nbsp;<cite>blastp -help</cite></li>
<li>break a command up over many lines by using&nbsp;<a href="http://angus.readthedocs.io/en/2016/running-command-line-blast.html#id1">`</a>` to &ldquo;escape&rdquo; the new line</li>
</ul><p>&nbsp;</p><p>Blastn</p><p>blastn [-h] [-help] [-import_search_strategy filename]<br /> [-export_search_strategy filename] [-task task_name] [-db database_name]<br /> [-dbsize num_letters] [-gilist filename] [-seqidlist filename]<br /> [-negative_gilist filename] [-negative_seqidlist filename]<br /> [-entrez_query entrez_query] [-db_soft_mask filtering_algorithm]<br /> [-db_hard_mask filtering_algorithm] [-subject subject_input_file]<br /> [-subject_loc range] [-query input_file] [-out output_file]<br /> [-evalue evalue] [-word_size int_value] [-gapopen open_penalty]<br /> [-gapextend extend_penalty] [-perc_identity float_value]<br /> [-qcov_hsp_perc float_value] [-max_hsps int_value]<br /> [-xdrop_ungap float_value] [-xdrop_gap float_value]<br /> [-xdrop_gap_final float_value] [-searchsp int_value]<br /> [-sum_stats bool_value] [-penalty penalty] [-reward reward] [-no_greedy]<br /> [-min_raw_gapped_score int_value] [-template_type type]<br /> [-template_length int_value] [-dust DUST_options]<br /> [-filtering_db filtering_database]<br /> [-window_masker_taxid window_masker_taxid]<br /> [-window_masker_db window_masker_db] [-soft_masking soft_masking]<br /> [-ungapped] [-culling_limit int_value] [-best_hit_overhang float_value]<br /> [-best_hit_score_edge float_value] [-window_size int_value]<br /> [-off_diagonal_range int_value] [-use_index boolean] [-index_name string]<br /> [-lcase_masking] [-query_loc range] [-strand strand] [-parse_deflines]<br /> [-outfmt format] [-show_gis] [-num_descriptions int_value]<br /> [-num_alignments int_value] [-line_length line_length] [-html]<br /> [-max_target_seqs num_sequences] [-num_threads int_value] [-remote]<br /> [-version]</p><p>DESCRIPTION<br /> Nucleotide-Nucleotide BLAST 2.7.0+</p></div>]]></description>
	<dc:creator>Shruti Paniwala</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43952/elastic-blast</guid>
	<pubDate>Tue, 06 Sep 2022 18:14:57 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43952/elastic-blast</link>
	<title><![CDATA[Elastic BLAST !]]></title>
	<description><![CDATA[<p><a href="https://blast.ncbi.nlm.nih.gov/doc/elastic-blast/elasticblast.html?utm_source=ncbi_insights&amp;utm_medium=referral&amp;utm_campaign=elasticblast-top3-20220823">ElasticBLAST</a>&nbsp;is a new way to&nbsp;<a href="https://blast.ncbi.nlm.nih.gov/?utm_source=ncbi_insights&amp;utm_medium=referral&amp;utm_campaign=elasticblast-top3-20220823">BLAST</a>&nbsp;large numbers of queries, faster and on the cloud. Here are the top three reasons you should use ElasticBLAST:</p>
<h6><strong><img src="https://i0.wp.com/ncbiinsights.ncbi.nlm.nih.gov/wp-content/uploads/2022/08/ElasticBLAST_Larger-e1659978198941.png?resize=150%2C120&amp;ssl=1" alt="" width="150" height="120" style="border: 0px;">1. ElasticBLAST can handle much LARGER queries!&nbsp;</strong></h6>
<p>ElasticBLAST can search query sets that have&nbsp;<em>hundreds to millions of sequences</em>&nbsp;and against BLAST databases of all sizes.</p>
<h6><span><img src="https://i0.wp.com/ncbiinsights.ncbi.nlm.nih.gov/wp-content/uploads/2022/08/ElasticBLAST_Faster.png?resize=150%2C120&amp;ssl=1" alt="" width="150" height="120" style="border: 0px;">2. ElasticBLAST is FASTER</span></h6>
<p>ElasticBLAST distributes your searches across multiple cloud instances to process them simultaneously. The ability to scale resources in this way allows you to process large numbers of queries in a shorter time than you could with BLAST+.</p>
<h6><img src="https://i0.wp.com/ncbiinsights.ncbi.nlm.nih.gov/wp-content/uploads/2022/08/ElasticBLAST_Easy.png?resize=150%2C120&amp;ssl=1" alt="" width="150" height="120" style="border: 0px;">3. ElasticBLAST is EASY to run on the cloud<strong><br></strong></h6>
<p>ElasticBLAST is easy to set up using our step-by-step instructions&nbsp;<span>(</span><a href="https://blast.ncbi.nlm.nih.gov/doc/elastic-blast/quickstart-aws.html?utm_source=ncbi_insights&amp;utm_medium=referral&amp;utm_campaign=elasticblast-top3-20220823" target="_blank"><span><span>Amazon Web&nbsp;</span><span>Services (AWS)</span></span></a><span>,&nbsp;</span><a href="https://blast.ncbi.nlm.nih.gov/doc/elastic-blast/quickstart-gcp.html?utm_source=ncbi_insights&amp;utm_medium=referral&amp;utm_campaign=elasticblast-top3-20220823" target="_blank"><span>Google Cloud Platform (GCP)</span></a><span><span>)</span>&nbsp;<span>and</span>&nbsp;<span>allows&nbsp;</span><span>you&nbsp;</span><span>to leverage the power of</span><span>&nbsp;the&nbsp;</span><span>cloud. Once configured, i</span><span>t</span>&nbsp;<span>manages the software and database installation, handles partitioning of the BLAST workload among the various instances, and deallocates cloud resources when the searches are done.</span></span></p>
<p><span><span>ElasticBLAST</span>&nbsp;<span>also&nbsp;</span><span>selects the instance (</span><span>i.e.,</span><span>&nbsp;machine) type for you based on database size. Of course, you can also choose the instance type manually if you prefer</span><span>.&nbsp;</span></span></p><p>Address of the bookmark: <a href="https://blast.ncbi.nlm.nih.gov/doc/elastic-blast/" rel="nofollow">https://blast.ncbi.nlm.nih.gov/doc/elastic-blast/</a></p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/fun/view/4196/chemical-elements-of-bioinformatics</guid>
	<pubDate>Tue, 03 Sep 2013 16:35:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/fun/view/4196/chemical-elements-of-bioinformatics</link>
	<title><![CDATA[Chemical Elements of Bioinformatics]]></title>
	<description><![CDATA[<p>You must be familiar with periodic table and colour pattern, but this time you are going to amaze by new elements table by Eagle genomics. Just check it out and have fun :)</p><p><a href="http://elements.eaglegenomics.com/">http://elements.eaglegenomics.com/</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38389/blast-options-setting-and-defaults</guid>
	<pubDate>Mon, 10 Dec 2018 08:29:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38389/blast-options-setting-and-defaults</link>
	<title><![CDATA[BLAST options, setting and defaults]]></title>
	<description><![CDATA[<p>BLAST stands for Basic Local Alignment Search Tool and was developed by Altschul et al. (1990) and significantly improved by&nbsp;<a href="http://www3.oup.co.uk/nar/Volume_25/Issue_17/freepdf/">Altschul et al. (1997).</a>&nbsp;It is a very fast search algorithm that is used to separately search protein or DNA databases. BLAST is best used for sequence similarity searching, rather than for motif searching. For searches using a query sequence of fewer than twenty residues,&nbsp;<a href="https://www.arabidopsis.org/servlets/tools/patmatch/">PatMatch</a>&nbsp;is the best choice. Another sequence alignment tool that may yield different results from BLAST, and may be useful for motif searching, is&nbsp;<a href="https://www.arabidopsis.org/cgi-bin/fasta/TAIRfasta.pl">FASTA</a>. To search nonplant datasets, try&nbsp;<a href="http://seqsim.ncgr.org/newBlast.html">NCGR BLAST</a>&nbsp;or&nbsp;<a href="http://www.ncbi.nlm.nih.gov/blast/blast.cgi?Jform=0">NCBI BLAST</a>.</p>
<p>A fairly complete on-line guide to BLAST searching can be found at the&nbsp;<a href="http://www.ncbi.nlm.nih.gov/BLAST/blast_help.html">NCBI BLAST Help Manual</a>. For a theoretical overview of BLAST, see the&nbsp;<a href="http://www.ncbi.nlm.nih.gov/BLAST/tutorial/Altschul-1.html">NCBI BLAST Course</a>. Additional information can be found in the&nbsp;<a href="https://www.arabidopsis.org/blast/aboutblast2.htm">BLAST 2.0 Release Notes</a></p>
<table border="1">
<tbody>
<tr><th>&nbsp;</th><th><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#methods">BLASTN</a></th><th><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#methods">BLASTP</a></th><th><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#methods">BLASTX</a></th><th><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#methods">TBLASTN</a></th><th><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#methods">TBLASTX</a></th><th><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#methods">PSIBLAST</a></th></tr>
<tr>
<td><a name="open" id="open"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#open"><strong>Gap opening penalty</strong></a>:<br>cost to open a gap [integer]</td>
<td align="center">default = 5</td>
<td align="center">default = 11<br>limited&nbsp;values&nbsp;are supported</td>
<td align="center">default = 11<br>limited&nbsp;values&nbsp;are supported</td>
<td align="center">default = 11<br>limited&nbsp;values&nbsp;are supported</td>
<td align="center">default = 11<br>limited&nbsp;values&nbsp;are supported</td>
<td align="center">default = 5</td>
</tr>
<tr>
<td><a name="extend" id="extend"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#extend"><strong>Gap extension penalty</strong></a>:<br>cost to extend a gap [integer]</td>
<td align="center">default = 2</td>
<td align="center">default = 1<br>a 0 in this field means to use the default</td>
<td align="center">default = 1<br>a 0 in this field means to use the default</td>
<td align="center">default = 1<br>a 0 in this field means to use the default</td>
<td align="center">default = 1<br>a 0 in this field means to use the default</td>
<td align="center">default = 2</td>
</tr>
<tr>
<td><a name="match" id="match"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#match"><strong>Nucleic match</strong></a>:<br>reward for a match in the BLAST portion of run [integer]</td>
<td align="center">default = 1</td>
<td align="center">n/a</td>
<td align="center">n/a</td>
<td align="center">n/a</td>
<td align="center">n/a</td>
<td align="center">default = 1</td>
</tr>
<tr>
<td><a name="mismatch" id="mismatch"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#mismatch"><strong>Nucleic mismatch</strong></a>:<br>penalty for a mismatch in the blast portion of run [integer]</td>
<td align="center">default = -3</td>
<td align="center">n/a</td>
<td align="center">n/a</td>
<td align="center">n/a</td>
<td align="center">n/a</td>
<td align="center">default = -3</td>
</tr>
<tr>
<td><strong><a name="expect" id="expect"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#expect">Expectation value</a></strong>:<br>(E) [real]</td>
<td align="center">default = 10.0</td>
<td align="center">default = 10.0</td>
<td align="center">default = 10.0</td>
<td align="center">default = 10.0</td>
<td align="center">default = 10.0</td>
<td align="center">default = 10.0</td>
</tr>
<tr>
<td><a name="word" id="word"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#word"><strong>Word size</strong></a>:<br>the size of the initial word that must be matched between the database and the query sequence</td>
<td align="center">default = 11</td>
<td align="center">default = 3</td>
<td align="center">default = 3</td>
<td align="center">default = 3</td>
<td align="center">default = 3</td>
<td align="center">default = 11</td>
</tr>
<tr>
<td><a name="descriptions" id="descriptions"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#descriptions"><strong>Max scores</strong></a>:<br>Number of one-line descriptions (V) [Integer]</td>
<td align="center">default = 25</td>
<td align="center">default = 25</td>
<td align="center">default = 25</td>
<td align="center">default = 25</td>
<td align="center">default = 25</td>
<td align="center">default = 25</td>
</tr>
<tr>
<td><strong><a name="alignments" id="alignments"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#alignments">Max alignments</a></strong>:<br>number of alignments to show (B) [integer]</td>
<td align="center">default = 15</td>
<td align="center">default = 15</td>
<td align="center">default = 15</td>
<td align="center">default = 15</td>
<td align="center">default = 15</td>
<td align="center">default = 15</td>
</tr>
<tr>
<td><strong>Query filter</strong>:<br>filter applied to the query sequence</td>
<td align="center">default = DUST</td>
<td align="center">default = SEG</td>
<td align="center">default = SEG</td>
<td align="center">default = SEG</td>
<td align="center">default = SEG</td>
<td align="center">default = DUST</td>
</tr>
<tr>
<td><strong><a name="gencodes" id="gencodes"></a><a href="https://www.arabidopsis.org/Blast/BLAST_help.jsp#gencodes">Query genetic code</a></strong>:<br>genetic code to be used in BLASTX translation of the query</td>
<td align="center">n/a</td>
<td align="center">n/a</td>
<td align="center">default = universal</td>
<td align="center">default = universal</td>
<td align="center">default = universal</td>
<td align="center">n/a</td>
</tr>
<tr>
<td><strong><a name="matrix" id="matrix"></a><a href="http://twod.med.harvard.edu/seqanal/matrices.html">Matrix</a></strong>:<br>substitution matrix to be used for amino acid comparisons</td>
<td align="center">no default</td>
<td align="center">default = blosum62</td>
<td align="center">default = blosum62</td>
<td align="center">default = blosum62</td>
<td align="center">default = blosum62</td>
<td align="center">no default</td>
</tr>
</tbody>
</table>
<p>Supported and Suggested&nbsp;Values&nbsp;for Gap Open and Extension in BLASTP, BLASTX, TBLASTN, and TBLASTX</p>
<table border="1">
<tbody>
<tr><th>Gaps Open</th><th>Gap Extension</th></tr>
<tr>
<td align="center">10</td>
<td align="center">1</td>
</tr>
<tr>
<td align="center">10</td>
<td align="center">2</td>
</tr>
<tr>
<td align="center">11</td>
<td align="center">1</td>
</tr>
<tr>
<td align="center">8</td>
<td align="center">2</td>
</tr>
<tr>
<td align="center">9</td>
<td align="center">2</td>
</tr>
</tbody>
</table><p>Address of the bookmark: <a href="https://www.arabidopsis.org/Blast/BLASToptions.jsp" rel="nofollow">https://www.arabidopsis.org/Blast/BLASToptions.jsp</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</guid>
	<pubDate>Sat, 07 Dec 2024 22:32:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</link>
	<title><![CDATA[A Step-by-Step Guide to Running BLAST Offline]]></title>
	<description><![CDATA[<p>BLAST (Basic Local Alignment Search Tool) is a powerful algorithm used to compare nucleotide or protein sequences to sequence databases, identifying regions of similarity. Running BLAST offline provides more control, ensures data security, and allows customization for specific research needs. Here&rsquo;s a detailed guide to set up and run BLAST locally on your system.</p><hr><h3>Step 1: <strong>Install BLAST</strong></h3><ol>
<li>
<p><strong>Download BLAST</strong>:</p>
<ul>
<li>Visit the <a href="https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/">NCBI BLAST+ download page</a> to download the appropriate version for your operating system (Windows, macOS, or Linux).</li>
</ul>
</li>
<li>
<p><strong>Install BLAST</strong>:</p>
<ul>
<li>Extract the downloaded archive. For Linux/Mac, use:
<pre><code>tar -xvzf ncbi-blast-*.tar.gz
cd ncbi-blast-*
</code></pre>
</li>
<li>Add the BLAST binary folder to your system PATH for easier access:
<pre><code>export PATH=$PATH:/path/to/ncbi-blast-*/bin
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Verify Installation</strong>:<br /> Run the following command to ensure BLAST is installed correctly:</p>
<pre><code>blastn -version
</code></pre>
</li>
</ol><hr><h3>Step 2: <strong>Prepare a Local Database</strong></h3><p>To run BLAST offline, you&rsquo;ll need a sequence database.</p><ol>
<li>
<p><strong>Download a Pre-Built Database (Optional)</strong>:</p>
<ul>
<li>NCBI provides ready-to-use databases such as <code>nt</code>, <code>nr</code>, and <code>Swiss-Prot</code>. Use the <code>update_blastdb.pl</code> script (bundled with BLAST) to download these:
<pre><code>update_blastdb.pl --decompress nt
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Create a Custom Database</strong>:<br /> If you have specific sequences to use as a database:</p>
<ul>
<li>Prepare a FASTA file containing the sequences.</li>
<li>Use <code>makeblastdb</code> to create a database:
<pre><code>makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
</code></pre>
Replace <code>[nucl|prot]</code> with <code>nucl</code> for nucleotide sequences or <code>prot</code> for protein sequences.</li>
</ul>
</li>
</ol><hr><h3>Step 3: <strong>Prepare the Query Sequence</strong></h3><ul>
<li>Save your query sequence(s) in FASTA format.</li>
<li>Ensure the file is properly formatted, with a header line starting with <code>&gt;</code> followed by the sequence name, and the sequence on subsequent lines.</li>
</ul><p>Example:</p><pre><code>&gt;query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA
</code></pre><hr><h3>Step 4: <strong>Run BLAST</strong></h3><ol>
<li>
<p><strong>Choose the Appropriate BLAST Tool</strong>:<br /> Depending on your data type:</p>
<ul>
<li><strong>blastn</strong>: For nucleotide-nucleotide searches.</li>
<li><strong>blastp</strong>: For protein-protein searches.</li>
<li><strong>blastx</strong>: Translates nucleotide sequences into proteins and compares them to a protein database.</li>
<li><strong>tblastn</strong>: Compares protein sequences to a nucleotide database.</li>
<li><strong>tblastx</strong>: Translates both nucleotide query and database sequences.</li>
</ul>
</li>
<li>
<p><strong>Run the Command</strong>:<br /> Example command for <code>blastn</code>:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
</code></pre>
<p><strong>Explanation of Parameters</strong>:</p>
<ul>
<li><code>-query</code>: Specifies the query file.</li>
<li><code>-db</code>: Points to the local database.</li>
<li><code>-out</code>: Output file name.</li>
<li><code>-outfmt</code>: Output format (e.g., 6 for tabular format).</li>
<li><code>-evalue</code>: E-value cutoff for significance.</li>
</ul>
</li>
</ol><hr><h3>Step 5: <strong>Interpret Results</strong></h3><ol>
<li>
<p><strong>Output Formats</strong>:</p>
<ul>
<li><strong>Default (outfmt 0)</strong>: Human-readable format.</li>
<li><strong>Tabular (outfmt 6)</strong>: Includes fields like query ID, subject ID, percent identity, alignment length, etc.</li>
</ul>
</li>
<li>
<p><strong>Analyze Results</strong>:<br /> Use tools like <code>grep</code>, Python, or R to parse and filter results for downstream analysis.</p>
</li>
</ol><hr><h3>Step 6: <strong>Optimize Performance</strong></h3><p>For large datasets, BLAST can be resource-intensive. To improve performance:</p><ol>
<li>
<p><strong>Multithreading</strong>:<br /> Use the <code>-num_threads</code> option to leverage multiple CPU cores:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
</code></pre>
</li>
<li>
<p><strong>Database Subsetting</strong>:<br /> Split large databases into smaller chunks for faster searches.</p>
</li>
<li>
<p><strong>Adjust Parameters</strong>:</p>
<ul>
<li>Lower the <code>-evalue</code> threshold for stricter matches.</li>
<li>Use <code>-max_target_seqs</code> to limit the number of results per query.</li>
</ul>
</li>
</ol><hr><h3>Step 7: <strong>Update Databases (Optional)</strong></h3><p>If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:</p><pre><code>update_blastdb.pl --decompress nt
</code></pre><hr><h3>Conclusion</h3><p>Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.</p><p>For advanced use cases, explore BLAST&rsquo;s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!</p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/4590/tigers-genome-sequenced</guid>
	<pubDate>Tue, 17 Sep 2013 16:48:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/4590/tigers-genome-sequenced</link>
	<title><![CDATA[Tigers genome sequenced]]></title>
	<description><![CDATA[<p>Fifteen scientists led by Dr Jong Bhak of Genome Research Foundation, South Korea, decoded as many as 3 billion nucleotides (organic molecules that form the basic building blocks of nucleic acids, such as DNA). They identified 20,000 genes related to various functions of the tiger.&nbsp;</p><p>The biggest and perhaps most fearsome of the world's big cats, the tiger, shares 95.6 percent of its DNA with humans' cute and furry companions, domestic cats.</p><p>The new research showed that big cats have genetic mutations that enabled them to be carnivores. The team also identified mutations that allow snow leopards to thrive at high altitudes.</p><p>Reference:</p><p><a href="http://www.nbcnews.com/science/your-cat-ferocious-tigers-share-lot-95-6-percent-their-4B11182690">http://www.nbcnews.com/science/your-cat-ferocious-tigers-share-lot-95-6-percent-their-4B11182690</a></p><p><a href="http://timesofindia.indiatimes.com/home/environment/flora-fauna/Gene-mapping-of-tiger-completed/articleshow/22671681.cms">http://timesofindia.indiatimes.com/home/environment/flora-fauna/Gene-mapping-of-tiger-completed/articleshow/22671681.cms</a></p><p>Paper:</p><p><a href="http://www.nature.com/ncomms/2013/130917/ncomms3433/full/ncomms3433.html">http://www.nature.com/ncomms/2013/130917/ncomms3433/full/ncomms3433.html</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36630/frequent-paired-end-reads-pe-2x100-mapping-command-lines</guid>
	<pubDate>Tue, 15 May 2018 08:59:29 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36630/frequent-paired-end-reads-pe-2x100-mapping-command-lines</link>
	<title><![CDATA[Frequent Paired-end reads (PE 2x100) mapping command lines]]></title>
	<description><![CDATA[
<p>bowtie2 -x hs37m -X 650 -q -1 r1.fq -2 r2.fq -S r12.bowtie2.sam  </p>

<p>bwa aln hs37m.fa r1.fq &gt; r1.sai &amp;&amp; bwa aln hs37m.fa r2.fq &gt; r2.sai \  <br />    &amp;&amp; bwa sampe hs37m r1.sai r2.sai r1.fq r2.fq &gt; r12.bwa.sam  </p>

<p>bwa bwasw ../index/bwa/hs37m.fa r12.fq &gt; r12.bwasw.sam  </p>

<p>gsnap -A sam -d hs37m r1.fq r2.fq &gt; r12.gsnap.sam  </p>

<p>novoalign -r Random -o SAM -f r1.fq r2.fq -i 500 50 -d hs37m-k14s3.novo &gt; r12.novo.sam  </p>

<p>smalt map -f samsoft -i 650 -o r12.smalt-k20s13.sam hs37m-k20s13 r1.fq r2.fq  </p>

<p>stampy.py -g hs37m -h hs37m -o r12.stampy.sam -M r1.fq,r2.fq  </p>

<p>soap -D hs37m.fa.index -a r1.fq -b r2.fq -l 32 -g 3 -u dummy -2 dummy -o r12.soap</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38012/cosine-non-seeding-method-for-mapping-long-noisy-sequences</guid>
	<pubDate>Fri, 26 Oct 2018 00:41:59 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38012/cosine-non-seeding-method-for-mapping-long-noisy-sequences</link>
	<title><![CDATA[COSINE: non-seeding method for mapping long noisy sequences]]></title>
	<description><![CDATA[<p><span>Third generation sequencing (TGS) are highly promising technologies but the long and noisy reads from TGS are difficult to align using existing algorithms. Here, we present COSINE, a conceptually new method designed specifically for aligning long reads contaminated by a high level of errors.</span></p><p>Address of the bookmark: <a href="https://github.com/SUwonglab/COSINE" rel="nofollow">https://github.com/SUwonglab/COSINE</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/11249/how-to-sequence-the-human-genome-mark-j-kiel</guid>
	<pubDate>Fri, 30 May 2014 13:24:11 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/11249/how-to-sequence-the-human-genome-mark-j-kiel</link>
	<title><![CDATA[How to sequence the human genome - Mark J. Kiel]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/MvuYATh7Y74" frameborder="0" allowfullscreen></iframe>View full lesson: http://ed.ted.com/lessons/how-to-sequence-the-human-genome-mark-j-kiel

Your genome, every human's genome, consists of a unique DNA sequence of A's, T's, C's and G's that tell your cells how to operate. Thanks to technological advances, scientists are now able to know the sequence of letters that makes up an individual genome relatively quickly and inexpensively. Mark J. Kiel takes an in-depth look at the science behind the sequence.

Lesson by Mark J. Kiel, animation by Marc Christoforidis.]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/27430/mosaik-a-hash-based-algorithm-for-accurate-next-generation-sequencing-short-read-mapping</guid>
	<pubDate>Fri, 20 May 2016 18:53:49 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/27430/mosaik-a-hash-based-algorithm-for-accurate-next-generation-sequencing-short-read-mapping</link>
	<title><![CDATA[MOSAIK: A Hash-Based Algorithm for Accurate Next-Generation Sequencing Short-Read Mapping]]></title>
	<description><![CDATA[<p><span>MOSAIK is a stable, sensitive and open-source program for mapping second and third-generation sequencing reads to a reference genome. Uniquely among current mapping tools, MOSAIK can align reads generated by all the major sequencing technologies, including Illumina, Applied Biosystems SOLiD, Roche 454, Ion Torrent and Pacific BioSciences SMRT. Indeed, MOSAIK was the only aligner to provide consistent mappings for all the generated data (sequencing technologies, low-coverage and exome) in the 1000 Genomes Project. To provide highly accurate alignments, MOSAIK employs a hash clustering strategy coupled with the Smith-Waterman algorithm. This method is well-suited to capture mismatches as well as short insertions and deletions. To support the growing interest in larger structural variant (SV) discovery, MOSAIK provides explicit support for handling known-sequence SVs, e.g. mobile element insertions (MEIs) as well as generating outputs tailored to aid in SV discovery.</span></p><p>Address of the bookmark: <a href="http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0090581" rel="nofollow">http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0090581</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

</channel>
</rss>