What Are Chromosome Rearrangements?

Chromosome rearrangements are structural changes that alter the normal configuration of chromosomes. These changes can involve large segments of DNA — from thousands to millions of base pairs — and can occur spontaneously, be inherited, or result from exposure to mutagens (like radiation or chemicals).

Common Types of Rearrangements:

1. Deletions – Loss of a chromosome segment

2. Duplications – Repetition of a segment

3. Inversions – A segment breaks off, flips, and reattaches

4. Translocations – Segments exchange places between non-homologous chromosomes

5. Insertions – A segment is inserted into another part of the genome

These changes can disrupt genes directly or affect gene regulation, leading to disease.

How Do Chromosome Rearrangements Cause Disease?

The impact of a rearrangement depends on which genes are involved, how much DNA is affected, and when the rearrangement occurs (in development vs. adulthood). Here are some key mechanisms:

• Gene disruption: Breaking a gene can lead to loss of function or the creation of a non-functional protein.

• Gene fusion: Joining parts of two genes may form a novel hybrid gene with new functions (common in cancer).

• Dosage effects: Extra or missing gene copies can disturb the balance of gene expression.

• Position effects: Moving a gene to a new regulatory environment may silence or over-activate it.

Chromosome Rearrangements in Human Disease

1. Developmental Disorders

• Cri-du-chat syndrome: Caused by a deletion on chromosome 5p. Affected infants often have a high-pitched cry and intellectual disability.

• Williams syndrome: Results from a microdeletion on chromosome 7q, affecting genes related to cardiovascular and cognitive function.

2. Cancer

Cancer is perhaps the most striking example of disease caused by chromosome rearrangements.

• Chronic Myeloid Leukemia (CML): Caused by a translocation between chromosomes 9 and 22, forming the Philadelphia chromosome. This creates the BCR-ABL fusion gene, which drives uncontrolled cell growth.

• Burkitt lymphoma: Involves translocation of the MYC gene, leading to excessive cell division.

• Ewing sarcoma: A fusion of EWSR1 and FLI1 genes through translocation promotes tumor development.

3. Infertility and Miscarriages

Balanced rearrangements (like inversions or translocations) in carriers may not cause disease directly but can result in:

• Recurrent miscarriages

• Infertility

• Birth defects in offspring

Detecting Rearrangements

Thanks to modern genomics, chromosome rearrangements can now be detected with high precision using:

• Karyotyping – Classic method for detecting large rearrangements

• FISH (Fluorescence In Situ Hybridization) – Uses fluorescent probes to target specific DNA sequences

• Array CGH (Comparative Genomic Hybridization) – Detects copy number changes across the genome

• Whole Genome Sequencing (WGS) – Identifies even small or complex rearrangements at base-pair resolution

Looking Forward: The Future of Chromosome Medicine

Understanding chromosome rearrangements is now central to:

• Personalized medicine

• Genetic counseling

• Targeted therapies, especially in cancer (e.g., tyrosine kinase inhibitors for BCR-ABL fusion)

With the rise of long-read sequencing and single-cell genomics, even previously “invisible” rearrangements are being uncovered, offering new insights into both rare diseases and common conditions.

Final Thoughts

Chromosome rearrangements remind us that genetics isn't just about which genes we have — but where they are, how they're arranged, and when they're active. As our tools grow sharper, so does our ability to diagnose, understand, and treat diseases rooted in genomic architecture.

In a way, the genome is like a book not just defined by its words, but also by how the chapters are ordered. Rearranging them can create a new story — sometimes harmful, sometimes insightful — and understanding these changes is key to writing a healthier future.

http://biogps.org/#goto=welcome

Address of the bookmark: http://biogps.org/#goto=welcome

Address of the bookmark: https://github.com/chilleo/ALPHA

Address of the bookmark: https://github.com/walaj/svaba

For example ... contig-stats.pl is a Perl script that will automatically describe features of a sequence assembly.

http://milkweedgenome.org/?q=scripts

Address of the bookmark: http://milkweedgenome.org/?q=scripts

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl