<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/37590?offset=1160</link>
	<atom:link href="https://bioinformaticsonline.com/related/37590?offset=1160" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/8504/update-genome-workbench-2715-released</guid>
	<pubDate>Wed, 26 Feb 2014 16:12:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/8504/update-genome-workbench-2715-released</link>
	<title><![CDATA[Update Genome Workbench 2.7.15 released]]></title>
	<description><![CDATA[<p>NCBI Genome Workbench is an integrated application for viewing and analyzing sequence data. With Genome Workbench, you can view data in publically available sequence databases at NCBI, and mix this data with your own private data.</p><p><img src="http://www.ncbi.nlm.nih.gov/core/assets/gbench/images/firstscreen_still.gif" alt="Introductory screen shot" style="border: 0px; border: 0px;"></p><p>Genome Workbench can display sequence data in many ways, including graphical sequence views, various alignment views, phylogenetic tree views, and tabular views of data. It can also align your private data to data in public databases, display your data in the context of public data, and retrieve BLAST results.</p><p>Genome Workbench is built on the NCBI C++ ToolKit and uses cross-platform APIs for graphics. It runs on your local machine, and is available for Windows 2000/XP, Linux, MacOS X, and various flavors of Unix.</p><p>NCBI Genome Workbench is an integrated application for viewing and analyzing sequence data. Genome Workbench was developed entirely in-house at NCBI and makes use of the NCBI C++ ToolKit. The C++ ToolKit provides a convenient and flexible cross-platform API for managing system internals, database connections, network sockets, and the NCBI data model. In addition, the C++ ToolKit provides the Object Manager, which abstracts handling of sequences and sequence-related objects.</p><p>&nbsp;New Features in Genome Workbench 2.7.15 <br /><br /></p><ul>
<li>Multiple Alignment View: implemented adaptive feature display when zooming in</li>
<li>Active Objects Inspector replaces Selection Inspector. New View should offer an improved selection context examination. See Using Active Objects Inspector tutorial for more details.</li>
<li>Binary packages for Linux OpenSUSE 13.1 are now available</li>
</ul><p><br />Bug Fixes and Improvements in Genome Workbench 2.7.15 <br /><br /></p><ul>
<li>Fixed major issue with OpenGL overlay/scrolling. Could cause crashes or view scrolling irregularities</li>
<li>Multiple Pane View: fixed crash on loading BLAST results</li>
<li>Graphical Sequence View: fixed crash on zooming in and out, related to SNP track</li>
<li>Graphical Sequence View: fixed Go To Position dialog to give better diagnostics in case of a user error</li>
<li>Graphical Sequence View: PDF export fixed rendering of Markers with commas in the name</li>
<li>Text View / Flat File: fixed Mac OS rendering issues</li>
<li>Text View / Flat File: performance optimization, extended capabilities of real-time rendering of molecules to tens of thousands</li>
<li>File Import: optimization improvement to speed up load of files containing multiple project items</li>
<li>File Import: remapping stage now shows accession.version and description of molecules, instead of plain GI numbers</li>
<li>Mac OS: improved tooltips for toolbar buttons</li>
<li>Phylogenetic Tree Builder Tool: improved diagnostics of errors</li>
<li>Multiple Alignment View: optimizations to avoid main GUI freezes</li>
<li>Open Dialog: removed duplicate elements in table of genomes (load Genome)</li>
<li>PDF export: fixed issue with XREF table errors</li>
<li>Tree View: fixed issues with showing Force Layout progress on Mac OS</li>
<li>Tree View: PDF export fixed issues for showing labels of collapsed nodes</li>
<li>Tree View: added an option to stop layout</li>
<li>Tree View: broadcasting mechanism fixed not to accumulate selected nodes</li>
</ul><p>Reference:</p><p>NCBI news</p><p>http://www.ncbi.nlm.nih.gov/tools/gbench/</p>]]></description>
	<dc:creator>Surabhi Chaudhary</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8857/junior-research-fellow-at-iari</guid>
  <pubDate>Mon, 10 Mar 2014 13:10:56 -0500</pubDate>
  <link></link>
  <title><![CDATA[Junior Research Fellow at IARI]]></title>
  <description><![CDATA[
<p>DIVISION OF NEMATOLOGY<br />INDIAN AGRICULTURAL RESEARCH INSTITUTE<br />NEW DELHI 110012</p>

<p>Applications are invited for the posts of one Junior Research Fellow in the DBT funded project entitled “Plant parasitic nematode genome informatics - insilico resource development”. The project is for a period of three years.</p>

<p>Essential qualifications for JRF: First class M. Sc. / M. Tech in Bioinformatics. Knowledge of programming language, pearl, Statistics and database – HTML, CSS, Java script.</p>

<p>Desirable qualifications: Experience in handling next generation sequencing data</p>

<p>Age limit: 35 years maximum (5 year relaxation for SC/ST and women candidates) Emoluments: 16,000 + 30% HRA.</p>

<p>The post is purely temporary in nature and is co-terminus with the project. The appointment would be initially for one year and may be extended further upon satisfactory performance.</p>

<p>Those who are interested in pursuing Ph.D with strong research aptitude are preferred.</p>

<p>Interested candidates may attend the Walk in interview on 25th March 2014 along with the duly filled application forms (format in the following page) with all the relevant documents.</p>

<p>Venue: Division of Nematology, Indian Agricultural Research Institute, New Delhi 110012 (Room No. 306, 3rd floor, LBS building)</p>

<p>Reporting Time: Interested candidates should report strictly between 10.00 to 10.30 AM.</p>

<p>Interview time: 10.30 AM</p>

<p>Short-listed candidates will be called for interview at New Delhi. However, no TA and DA will be paid for attending the interview.</p>

<p>Advertisement:</p>

<p>https://www.iari.res.in/files/JRF_Nema-07032014-20140307-170017.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</guid>
	<pubDate>Wed, 11 Apr 2018 13:31:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/36211/project-based-approach-to-improve-bioinformatics-education-with-skilled-and-meaningful-access-to-omics-data</link>
	<title><![CDATA[Project-based approach to improve bioinformatics education with skilled and meaningful access to omics data]]></title>
	<description><![CDATA[<p>Pine Biotech has been collaborating with Loyola University of New Orleans on piloting a new approach to bioinformatics education using the intuitive and logic-drive bioinformatics platform T-BioInfo.</p><p>https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8972/bioinformaticcomputational-postdoc-at-south-dakota-state-university</guid>
  <pubDate>Wed, 12 Mar 2014 10:02:30 -0500</pubDate>
  <link></link>
  <title><![CDATA[Bioinformatic/computational postdoc at South Dakota State University]]></title>
  <description><![CDATA[
<p>We seek an enthusiastic postdoctoral researcher to work with the Plant Science team within the Biochemical Spatio-temporal NeTwork Resource (BioSNTR). Bio-SNTR</p>

<p>is a state-funded virtual research center aimed at promoting imaging and informatics research infrastructure in South Dakota. BioSNTR research foci include analysis of large-scale genomics and imaging data, application of novel microscopy technologies to study signaling pathways, and identification of new compounds to manipulate signaling pathways.<br />Responsibilities: This person will be part of Plant Science team with research focus in bioinformatic and molecular network analyses of high throughput data (transcriptomic, proteomic, metabolomics, miRNA). The individual will be integrated into functional genomic projects encompassing grapevine dormancy and freezing tolerance (Fennell) and regulation of soybean nodulation (Subramanian). The successful candidate will perform computational analysis of high throughput, next-generation sequence data and possess the ability to use bioinformatics analytical tools on HPC clusters.</p>

<p> <br />Required Qualifications:<br />• Ph.D. in plant computational biology or bioinformatics.<br />• Experience in a high performance computing environment.<br />• Perl, Python and Java programming experience<br />• Data management and database development experience</p>

<p>Desired Qualifications:<br />• Parallel computing experience<br />• Experience working in a multidisciplinary environment</p>

<p>Contact Information<br />South Dakota State University<br />Plant Science<br />Anne Fennell<br />anne.fennell@sdstate.edu<br />Tel. Number: 605-688-6373<br />http://www.biosntr.org</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/9029/syntax-for-secure-copy-scp</guid>
	<pubDate>Thu, 13 Mar 2014 17:01:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/9029/syntax-for-secure-copy-scp</link>
	<title><![CDATA[Syntax for Secure Copy (scp)]]></title>
	<description><![CDATA[<div><p>In our day to day research activity, we need to securely copy our data from several to local computer and visa-versa. I am jotting down some of the commonly used SCP command for your future help. Hope you all will like it</p><p>What is Secure Copy?<br /><br />scp allows files to be copied to, from, or between different hosts. It uses ssh for data transfer and provides the same authentication and same level of security as ssh.</p><p><br />Examples</p><p><br /><strong>Copy the file "gene.txt" from a remote host to the local host</strong><br /><br />&nbsp;&nbsp;&nbsp; $ scp your_username@remotehost.edu:gene.txt /some/local/directory<br /><br /><strong>Copy the file "foobar.txt" from the local host to a remote host</strong><br /><br />&nbsp;&nbsp;&nbsp; $ scp gene.txt your_username@remotehost.edu:/some/remote/directory<br /><br /><strong>Copy the directory "chromosome" from the local host to a remote host's directory "bar"</strong><br /><br />&nbsp;&nbsp;&nbsp; $ scp -r chromosome your_username@remotehost.edu:/some/remote/directory/bar<br /><br /><strong>Copy the file "gene.txt" from remote host "rh1.edu" to remote host "rh2.edu"</strong><br /><br />&nbsp;&nbsp;&nbsp; $ scp your_username@rh1.edu:/some/remote/directory/gene.txt \<br />&nbsp;&nbsp;&nbsp; your_username@rh2.edu:/some/remote/directory/<br /><br /><strong>Copying the files "gene.txt" and "cancer.txt" from the local host to your home directory on the remote host</strong><br /><br />&nbsp;&nbsp;&nbsp; $ scp gene.txt cancer.txt your_username@remotehost.edu:~<br /><br /><strong>Copy the file "gene.txt" from the local host to a remote host using port 2264</strong><br /><br />&nbsp;&nbsp;&nbsp; $ scp -P 2264 gene.txt your_username@remotehost.edu:/some/remote/directory<br /><br /><strong>Copy multiple files from the remote host to your current directory on the local host</strong><br /><br />&nbsp;&nbsp;&nbsp; $ scp your_username@remotehost.edu:/some/remote/directory/\{a,b,c\} .<br /><br />&nbsp;&nbsp;&nbsp; $ scp your_username@remotehost.edu:~/\{gene.txt,cancer.txt\} .<br /><br /><strong>scp Performance</strong><br /><br />By default scp uses the Triple-DES cipher to encrypt the data being sent. Using the Blowfish cipher has been shown to increase speed. This can be done by using option -c blowfish in the command line.<br /><br />&nbsp;&nbsp;&nbsp; $ scp -c blowfish some_file your_username@remotehost.edu:~<br /><br />It is often suggested that the -C option for compression should also be used to increase speed. The effect of compression, however, will only significantly increase speed if your connection is very slow. Otherwise it may just be adding extra burden to the CPU. An example of using blowfish and compression:<br /><br />&nbsp;&nbsp;&nbsp; $ scp -c blowfish -C local_file your_username@remotehost.edu:~</p></div>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</guid>
	<pubDate>Wed, 05 Jun 2019 15:04:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</link>
	<title><![CDATA[Bioinformatics for Precision Oncology - Online Training Program, Summer 2019]]></title>
	<description><![CDATA[<p><img src="https://edu.t-bio.info/wp-content/uploads/2019/05/OncologyBioinformatics.jpeg" width="600" height="337.5" alt="image" style="border: 0px;"></p><p>The bioinforamtics for precision oncology online course provides an opportunity to learn about bioinformatics methods used in precision oncology research and practice. As a subset of precision medicine, precision oncology deals with molecular factors involved in the biological rpocesses that lead to cancer and can help diagnose, treat or prevent this disease. Oncology is driven by data, often times generated using Next Generation Sequencing (NGS) that helps us study the genomic and transcriptomic sub-cellular processes. Learn more and register:&nbsp;https://edu.t-bio.info/bioinformatics-training-precision-oncology/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/10391/research-associate-ra-at-iob</guid>
  <pubDate>Mon, 05 May 2014 08:38:54 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Associate (RA) at IOB]]></title>
  <description><![CDATA[
<p>Applications are invited for a post of Research Associate (RA) or Senior Research Fellow (SRF) in the ICMR project on "Integrated Analysis of Multi-omics Data in Human Gliomas".</p>

<p>We are looking for a motivated candidate for handling proteomic and/or transcriptomic and other data with a strong background in bioinformatics tools and database development. The project will include identification of novel peptides from mass spectrometry-based proteomic data.</p>

<p>Familiarity with statistical tools or wet lab experience will be an added advantage. The position is open for immediate appointment and available for two years. The applicant will be appointed as Research Associate or Senior Research Fellow based on qualifications as detailed below:</p>

<p>Research Associate: Ph.D. in Biological Science or Bioinformatics with relevant publications in peer reviewed journals. Familiarity with bioinformatics tools, database development, programming skills and proteomic and/or other omics data analysis. Salary will be as per ICMR rules and guidelines.</p>

<p>Senior Research Fellow: M.Sc./B.Tech. in any branch of biology/ biotechnology/bioinformatics, with minimum 2 years of research experience (essential). Familiarity with bioinformatics tools, database development, programming skills and proteomic data analysis. Salary will be as per ICMR rules and guidelines.</p>

<p>Application will be shortlisted based on CV, reference letters from mentors and telephonic interview. Candidates will be called for a personal interview at Bangalore before appointment. No travel expense will be provided for attending interview at Bangalore.</p>

<p>Interested candidates may send a Letter of Interest and CV by email to: ravi@ibioinformatics.org on or before May 15th, 2014.</p>

<p>Contact:<br />Dr. Ravi Sirdeshmukh<br />Distinguished Scientist &amp; Associate Director, IOB,<br />Principal Advisor MSMC/MSCTR</p>

<p>Advertisement: www.ibioinformatics.org/careers.php</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</guid>
	<pubDate>Thu, 24 Oct 2019 10:30:25 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40204/iitm-tokyo-tech-joint-symposium</link>
	<title><![CDATA[IITM-Tokyo Tech Joint Symposium]]></title>
	<description><![CDATA[<p>The IITM-Tokyo Tech Joint Symposium is a biannual international symposium held in Indian Institute of Technology Madras (IITM), India in collaboration with Tokyo Institute of Technology (Tokyo-Tech), Japan. During the symposium, experts in various domains of Bioinformatics gather from India and Japan under one roof to discuss and present their works. This provides an unique opportunity to the researchers and students to learn the frontiers and interact with eminent scientists in Bioinformatics. The 5th IITM - Tokyo Tech Joint Symposium titled "Current trends in Bioinformatics: Big data analysis, machine learning and drug design", will be held on 6th - 7th March 2020 in IITM, Chennai, India.</p><p>The symposium will focus on topics in the below mentioned areas.</p><p>Topics: Algorithms for biomolecular sequences / structures Bioinformatics databases and tools Protein function Structure based drug design Machine learning Deep learning Large scale data analysis Big Data NGS Analysis Protein interactions/network Molecular modelling/docking/screening Biomolecular structure and function More</p><p>Info: https://web.iitm.ac.in/bioinfo2/symposium2020/home</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>