<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/37590?offset=1310</link>
	<atom:link href="https://bioinformaticsonline.com/related/37590?offset=1310" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/4882/detect-the-sequence-pattern-and-its-location-in-fasta-file-with-match-and-mismatches-information</guid>
	<pubDate>Thu, 26 Sep 2013 15:02:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/4882/detect-the-sequence-pattern-and-its-location-in-fasta-file-with-match-and-mismatches-information</link>
	<title><![CDATA[Detect the sequence pattern and its location in fasta file with match and mismatches information.]]></title>
	<description><![CDATA[<p>This script is one of my old script to detect some centromeric pattern in chromosomes. User can also control the number of mismatches allowed through command line ..</p><p>To run:</p><p>perl centro.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/4882" length="3596" type="text/x-perl" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/11249/how-to-sequence-the-human-genome-mark-j-kiel</guid>
	<pubDate>Fri, 30 May 2014 13:24:11 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/11249/how-to-sequence-the-human-genome-mark-j-kiel</link>
	<title><![CDATA[How to sequence the human genome - Mark J. Kiel]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/MvuYATh7Y74" frameborder="0" allowfullscreen></iframe>View full lesson: http://ed.ted.com/lessons/how-to-sequence-the-human-genome-mark-j-kiel

Your genome, every human's genome, consists of a unique DNA sequence of A's, T's, C's and G's that tell your cells how to operate. Thanks to technological advances, scientists are now able to know the sequence of letters that makes up an individual genome relatively quickly and inexpensively. Mark J. Kiel takes an in-depth look at the science behind the sequence.

Lesson by Mark J. Kiel, animation by Marc Christoforidis.]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/33689/bio-graphics-237</guid>
	<pubDate>Sun, 25 Jun 2017 17:52:21 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/33689/bio-graphics-237</link>
	<title><![CDATA[Bio-Graphics-2.37]]></title>
	<description><![CDATA[<p>BioPerl modules&nbsp;<a href="http://search.cpan.org/~lds/Bio-Graphics-2.37/lib/Bio/Graphics.pm">Bio::Graphics</a>&nbsp;+&nbsp;<a href="http://search.cpan.org/~cjfields/BioPerl-1.6.923/Bio/DB/GFF.pm">Bio::DB:GFF</a>&nbsp;and example scripts. It can draw some of the (but not all) feature types GBrowse can draw. This script should contain everything you can probably make use of (e.g. transcripts, segments, etc.) and you can try to find a good way of visualization by experimenting with its options.</p>
<p>http://search.cpan.org/~lds/Bio-Graphics-2.37/</p><p>Address of the bookmark: <a href="http://search.cpan.org/~lds/Bio-Graphics-2.37/" rel="nofollow">http://search.cpan.org/~lds/Bio-Graphics-2.37/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/11354/genomics-and-personalized-medicine</guid>
	<pubDate>Sun, 01 Jun 2014 23:38:42 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/11354/genomics-and-personalized-medicine</link>
	<title><![CDATA[Genomics and Personalized Medicine]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/pgHAXCMMcro" frameborder="0" allowfullscreen></iframe>(October 20, 2009) Michael Snyder, Professor of Genetics and Chair of the Department of Genetics at Stanford, discusses advances in gene sequencing, the impact of genomics on medicine, the potential for personalized medicine. and efforts at Stanford to further study these issues.

Stanford Mini Med School is a series arranged and directed by Stanford's School of Medicine, and presented by the Stanford Continuing Studies program. Featuring more than thirty distinguished, faculty, scientists and physicians from Stanford's medical school, the series offers students a dynamic introduction to the world of human biology, health and disease, and the groundbreaking changes taking place in medical research and health care.

Stanford University
http://www.stanford.edu

Stanford University School of Medicine
http://med.stanford.edu

Stanford Continuing Studies
http://continuingstudies.stanford.edu

Stanford University Channel on YouTube:
http://www.youtube.com/stanford]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35119/frontend-perl-web-framework-documentation-andrej-sali-lab</guid>
	<pubDate>Mon, 08 Jan 2018 22:32:03 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35119/frontend-perl-web-framework-documentation-andrej-sali-lab</link>
	<title><![CDATA[Frontend: Perl Web framework documentation - Andrej Sali Lab]]></title>
	<description><![CDATA[<p><span>The frontend is a set of Perl classes that displays the web interface, allowing a user to upload their input files, start a job, display a list of all jobs in the system, and get back job results. The main&nbsp;</span><a href="https://saliweb.readthedocs.io/en/latest/modules/frontend.html#saliwebfrontend" title="saliwebfrontend"><code><span>saliwebfrontend</span></code></a><span>&nbsp;class must be subclassed for each web service. This class is then used to display the web pages using a set of CGI scripts that are set up automatically by the build system.</span></p><p>Address of the bookmark: <a href="https://saliweb.readthedocs.io/en/latest/frontend.html" rel="nofollow">https://saliweb.readthedocs.io/en/latest/frontend.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/11434/adhoc-bioinformatics-faculty-position-nit</guid>
  <pubDate>Tue, 03 Jun 2014 16:19:52 -0500</pubDate>
  <link></link>
  <title><![CDATA[Adhoc Bioinformatics Faculty Position @ NIT]]></title>
  <description><![CDATA[
<p>NATIONAL INSTITUTE OF TECHNOLOGY, DEPARTMENT OF BIOTECHNOLOGY, WARANGAL – 506 021, Andhra Pradesh</p>

<p>No.NITW/BT/2014/adhoc</p>

<p>APPLICATIONS ARE INVITED FOR THE APPOINTMENT OF ADHOC FACULTY ON CONTRACT BASIS IN THE DEAPARTMENT OF BIOTECHNOLOGY</p>

<p>Period of Contract: Initially the appointment is for one semester i.e., from July 2014 up to December 2014 only.</p>

<p>Essential Qualifications:</p>

<p>i) B. Tech or equivalent in Biotechnology/ Industrial Biotechnology/ Biochemical Engineering / Chemical Engg. Or M. Sc in Microbiology/ Botany/ Zoology/ Biochemistry/Biotechnology and ii) M. Tech or equivalent in Biotechnology/Industrial Biotechnology/Bioinformatics</p>

<p>Or</p>

<p>Integrated M. Tech in Biotechnology/Industrial Biotechnology/ Bioinformatics</p>

<p>Candidates must possess First class (60% aggregate marks or 6.5 CGPA) at B. Tech/ M. Sc and M. Tech.</p>

<p>Desirable: Ph. D Pay Package: All selected candidates shall be eligible for a consolidated pay of Rs.30, 000/- per month. Candidates with Ph. D shall be eligible for an additional amount of Rs.5, 000/- per month.</p>

<p>How to apply : Applications on plain paper with attested photocopies of certificate and bio data along with justification for eligibility should reach to the Head, Department of Biotechnology, National Institute of Technology, Warangal AP 506004 in the form of soft or hard copy on or before 21st June 2014 email : biotech_hod@nitw.ac.in</p>

<p>Intimation: No separate call letters will be sent to the candidates. All the eligible candidates will be notified in the institute web site on 23rd June 2014. All the eligible candidates are requested to report for the interview to the Head, Department of Biotechnology at 9:00 AM on 27th June 2014</p>

<p>Joining: Selected candidates will be informed and they are expected to join immediately.</p>

<p>Advertisement:</p>

<p>http://www.nitw.ac.in/nitw/announcements/2014/Bio-Adhoc%20Advt.%20May-2014.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/11735/search-shell-command-history</guid>
	<pubDate>Thu, 12 Jun 2014 17:43:34 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/11735/search-shell-command-history</link>
	<title><![CDATA[Search Shell Command History]]></title>
	<description><![CDATA[<p>We use couple of hundreads of command in daily basis. Most of them are actually repeated several time. The question remain open how do I search old command history under bash shell and modify or reuse it? <br /><br />Now a days almost all modern shell allows you to search command history if enabled by user. Use history command to display the history list with line numbers. Lines listed with with a * have been modified by user.</p><p><br /><strong>Shell history search command</strong><br /><br />Type history at a shell prompt:<br />$ history</p><p>It will display the list of all used commandline history with an serial number.<br /><br />To search particular command, enter:<br />$ history | grep command-name<br />$ history | egrep -i 'scp|ssh|ftp'<br />Emacs Line-Edit Mode Command History Searching<br /><br />To get previous command containing string, hit [CTRL]+[r] followed by search string:<br /><br />(reverse-i-search): <br /><br />To get previous command, hit [CTRL]+[p]. You can also use up arrow key.<br /><br />CTRL-p<br /><br />To get next command, hit [CTRL]+[n]. You can also use down arrow key.<br /><br />CTRL-n<br /><br /></p><p><strong>fc command</strong></p><p>Apart from hostory command there are fc command to extract the command from history. The fc stands for either "find command" or "fix command.</p><p>For example list last 10 command, enter:<br />$ fc -l 10<br />To list commands 130 through 150, enter:<br />$ fc -l 130 150<br />To list all commands since the last command beginning with ssh, enter:<br />$ fc -l ssh<br />You can edit commands 1 through 5 using vi text editor, enter:<br />$ fc -e vi 1 5</p><p><strong>Delete command history</strong><br /><br />The -c option causes the history list to be cleared by deleting all of the entries:<br />$ history -c</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/11609/bioinformatician%E2%80%99s-pocket-reference</guid>
	<pubDate>Sun, 08 Jun 2014 09:56:58 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/11609/bioinformatician%E2%80%99s-pocket-reference</link>
	<title><![CDATA[Bioinformatician’s Pocket Reference !!]]></title>
	<description><![CDATA[<p><span>It is amusing how brain of bioinformaticians work! Learning a new programming language for days feels so much of fun that making 5 minute discussion with neighbours (unless under special circumstances!) in our own mother-tongue. Today every bioinformatician keeps more than few languages and core IT toolkits on their plate. It has become mandatory to be able to mould different code snippets to build our own custom workflows, and thus keeping syntax at our fingertips has become essential.Although Google is best way to get syntax problem solved, it is not a bad idea to keep reference sheets is our smartphones or stick out some printed sheets on the back of your door, in the old fashion way!!</span></p><p>Address of the bookmark: <a href="http://infoplatter.wordpress.com/2014/04/06/bioinformaticians-pocket-reference/" rel="nofollow">http://infoplatter.wordpress.com/2014/04/06/bioinformaticians-pocket-reference/</a></p>]]></description>
	<dc:creator>RAJESH DETROJA</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/42921/run-bash-script-in-perl-program</guid>
	<pubDate>Sat, 27 Feb 2021 01:42:23 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/42921/run-bash-script-in-perl-program</link>
	<title><![CDATA[Run bash script in Perl program !]]></title>
	<description><![CDATA[<p>BioPerl is a compilation of Perl modules that can be used to build bioinformatics-related Perl scripts. It is used, for example, in the development of source codes, standalone software/tools, and algorithms in bioinformatics programmes. Different modules are easy to instal and include, making it easier to perform different functions. Despite the fact that Python is commonly favoured over Perl, some bioinformatics software, such as the standalone version of 'alienomics', is written in Perl. Often it's a major problem for beginners to execute certain Unix/shell commands in Perl script, so it's hard to determine which feature is unique to a situation.</p><div style="background-color: white;">Perl provides various features and operators for the execution of external commands (described as follows), which are unique in their own way.</div><div style="background-color: white;">&nbsp;</div><div style="background-color: white;">They vary slightly from one another, making it difficult for Perl beginners to choose between them.</div><div style="background-color: white;">&nbsp;</div><div style="background-color: white;"><strong>1. IPC::Open2</strong></div><p>More at https://bioinformaticsonline.com/snippets/view/42919/perl-ipcopen2-module</p><p><strong>2. exec&rdquo;&rdquo;</strong></p><p><em>&nbsp;syntax:&nbsp;</em><code>exec "command";</code></p><div style="background-color: #edfbff;">It's a Perl function (perlfunc) that executes a command but never returns, similar to a function's return statement.</div><div style="background-color: white;">While running the command, it keeps processing the script and does not wait until it finishes first, returns false when the command is not found, but never returns true.</div><p><strong>3. Backticks &ldquo; or qx//</strong></p><p><em>syntax:&nbsp;</em><code>`command`;</code></p><p><em>syntax:&nbsp;</em><code>qx/command/;</code></p><div style="background-color: white;">It's a Perl operator (perlop) that executes a command and then resumes the Perl script once the command has ended, but the return value is the command's STDOUT.</div><p><strong>4. IPC::Open3</strong></p><p><em>syntax:&nbsp;</em><code>$output =&nbsp;open3(\*CHLD_IN, \*CHLD_OUT, \*CHLD_ERR,&nbsp;'command arg1 arg2', 'optarg',...);</code></p><p style="text-align: justify;"><code></code>It is very similar to <code>IPC::Open2</code> with the capability to capture all three file handles of the process, i.e., STDIN, STDOUT, and STDERR. It can also be used with or without the shell. You can read about it more in the documentation: <a href="https://perldoc.perl.org/IPC/Open3.html" target="_blank">IPC::Open3</a>.</p><p><code>$output = open3(my $o ut,&nbsp;my $in, 'command arg1 arg2');</code></p><p>OR without using the shell</p><p><code>$output = open3(my $out,&nbsp;my $in, 'command', 'arg1', 'arg2');</code></p><p><strong>5.a2p</strong></p><p><em>syntax:&nbsp;</em><code>a2p [options] [awkscript]</code></p><p>There is a Perl utility known as <code>a2p</code> which translates <code>awk</code> command to Perl. It takes awk script as input and generates a comparable Perl script as the output. Suppose, you want to execute the following <code>awk</code> statement</p><p><code>awk '{$1 = ""; $2 = ""; print}' f1.txt</code></p><p>This statement gives error sometimes even after escaping the variables (\$1, \$2) but by using <code>a2p</code> it can be easily converted to Perl script:</p><p>For further information, you can read it&rsquo;s documentation: <code><a href="https://perldoc.perl.org/a2p.html" target="_blank">a2p</a></code></p><p>More help at https://bioinformaticsonline.com/snippets/view/42920/perl-script-to-run-awk-inside-perl</p><p><strong>6. system()</strong></p><p><em>syntax:&nbsp;</em><code>system( "command" );</code></p><p>It is also a Perl function (<a href="https://perldoc.perl.org/functions/system.html" target="_blank">perlfunc</a>) that executes a command and waits for it to get finished first and then resume the Perl script. The return value is the exit status of the command. It can be called in two ways:</p><p><code>system( "command arg1 arg2" );</code></p><p>OR</p><p><code>system( "command", "arg1", "arg2" );</code></p><p>HELP</p><p>Here are some useful Perl cheat sheets that can be used as a quick reference guide.--&nbsp;<a href="https://www.pcwdld.com/perl-cheat-sheet" target="_blank">https://www.pcwdld.com/perl-cheat-sheet</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

</channel>
</rss>