Bioinformatics Textbook Track

Find more about Rosalind puzzle at http://rosalind.info/problems/list-view/?location=bioinformatics-textbook-track

I will provide solution of all the Rosalind problem with Perl for community.

Check out the right sidebar for more links ...

More at http://cpansearch.perl.org/src/TJPARNELL/

Address of the bookmark: http://cpansearch.perl.org/src/TJPARNELL/

Many of the Perl scripts require that the VCF files are compressed by bgzip and indexed by tabix (both tools are part of the tabix package, available for download here). The VCF files can be compressed and indexed using the following commands

bgzip my_file.vcf
tabix -p vcf my_file.vcf.gz

http://vcftools.sourceforge.net/perl_module.html

Address of the bookmark: http://vcftools.sourceforge.net/perl_module.html

More about the basic perl module installation steps check this http://bioinformaticsonline.com/blog/view/710/how-to-install-perl-modules-manually-using-cpan-command-and-other-quick-ways

installing Bio::SCF perl module is daunting task, specieally because of it dependencies. Here is the steps, you need to follow to sucessfully install Bio::SCF module

#sudo apt-get install libbio-scf-perl #trev for visualization of scf file

1. You will need the zlib library which can be found at http://www.zlib.net/.

install zlib library first:

jitendra@jitendra-UNLOCK-INSTALL[zlib-1.2.11] ./configure []
Checking for gcc...
Checking for shared library support...
Building shared library libz.so.1.2.11 with gcc.
Checking for size_t... Yes.
Checking for off64_t... Yes.
Checking for fseeko... Yes.
Checking for strerror... Yes.
Checking for unistd.h... Yes.
Checking for stdarg.h... Yes.
Checking whether to use vs[n]printf() or s[n]printf()... using vs[n]printf().
Checking for vsnprintf() in stdio.h... Yes.
Checking for return value of vsnprintf()... Yes.
Checking for attribute(visibility) support... Yes.
jitendra@jitendra-UNLOCK-INSTALL[zlib-1.2.11] make []
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -I. -c -o example.o test/example.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o adler32.o adler32.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o crc32.o crc32.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o deflate.o deflate.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o infback.o infback.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o inffast.o inffast.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o inflate.o inflate.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o inftrees.o inftrees.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o trees.o trees.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o zutil.o zutil.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o compress.o compress.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o uncompr.o uncompr.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o gzclose.o gzclose.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o gzlib.o gzlib.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o gzread.o gzread.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -c -o gzwrite.o gzwrite.c
ar rc libz.a adler32.o crc32.o deflate.o infback.o inffast.o inflate.o inftrees.o trees.o zutil.o compress.o uncompr.o gzclose.o gzlib.o gzread.o gzwrite.o
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -o example example.o -L. libz.a
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -I. -c -o minigzip.o test/minigzip.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -o minigzip minigzip.o -L. libz.a
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/adler32.o adler32.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/crc32.o crc32.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/deflate.o deflate.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/infback.o infback.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/inffast.o inffast.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/inflate.o inflate.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/inftrees.o inftrees.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/trees.o trees.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/zutil.o zutil.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/compress.o compress.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/uncompr.o uncompr.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/gzclose.o gzclose.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/gzlib.o gzlib.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/gzread.o gzread.c
gcc -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -DPIC -c -o objs/gzwrite.o gzwrite.c
gcc -shared -Wl,-soname,libz.so.1,--version-script,zlib.map -O3 -fPIC -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -o libz.so.1.2.11 adler32.lo crc32.lo deflate.lo infback.lo inffast.lo inflate.lo inftrees.lo trees.lo zutil.lo compress.lo uncompr.lo gzclose.lo gzlib.lo gzread.lo gzwrite.lo -lc
rm -f libz.so libz.so.1
ln -s libz.so.1.2.11 libz.so
ln -s libz.so.1.2.11 libz.so.1
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -o examplesh example.o -L. libz.so.1.2.11
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -o minigzipsh minigzip.o -L. libz.so.1.2.11
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -I. -D_FILE_OFFSET_BITS=64 -c -o example64.o test/example.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -o example64 example64.o -L. libz.a
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -I. -D_FILE_OFFSET_BITS=64 -c -o minigzip64.o test/minigzip.c
gcc -O3 -D_LARGEFILE64_SOURCE=1 -DHAVE_HIDDEN -o minigzip64 minigzip64.o -L. libz.a
jitendra@jitendra-UNLOCK-INSTALL[zlib-1.2.11] sudo make install []
[sudo] password for jitendra:
rm -f /usr/local/lib/libz.a
cp libz.a /usr/local/lib
chmod 644 /usr/local/lib/libz.a
cp libz.so.1.2.11 /usr/local/lib
chmod 755 /usr/local/lib/libz.so.1.2.11
rm -f /usr/local/share/man/man3/zlib.3
cp zlib.3 /usr/local/share/man/man3
chmod 644 /usr/local/share/man/man3/zlib.3
rm -f /usr/local/lib/pkgconfig/zlib.pc
cp zlib.pc /usr/local/lib/pkgconfig
chmod 644 /usr/local/lib/pkgconfig/zlib.pc
rm -f /usr/local/include/zlib.h /usr/local/include/zconf.h
cp zlib.h zconf.h /usr/local/include
chmod 644 /usr/local/include/zlib.h /usr/local/include/zconf.h
 

2. Now make io_lib-1.9

In order to install this perl extension you have to install io-lib version 1.9 or higher from the Staden library (staden.sourceforge.net). This can be downloaded from https://sourceforge.net/project/showfiles.php?group_id=100316&package_id=108243&release_id=340318 confirm that the package installed correctly look for a library named "libread".

jitendra@jitendra-UNLOCK-INSTALL[io_lib-1.9.0] export CFLAGS="-fPIC" && ./configure
checking for a BSD-compatible install... /usr/bin/install -c
checking whether build environment is sane... yes
checking for gawk... gawk
checking whether make sets $(MAKE)... yes
checking for gcc... gcc
checking for C compiler default output file name... a.out
checking whether the C compiler works... yes
checking whether we are cross compiling... no
checking for suffix of executables...
checking for suffix of object files... o
checking whether we are using the GNU C compiler... yes
checking whether gcc accepts -g... yes
checking for gcc option to accept ANSI C... none needed
checking for style of include used by make... GNU
checking dependency style of gcc... gcc3
checking for a BSD-compatible install... /usr/bin/install -c
checking for ranlib... ranlib
checking for main in -lz... yes
checking how to run the C preprocessor... gcc -E
checking for egrep... grep -E
checking for ANSI C header files... yes
checking for sys/wait.h that is POSIX.1 compatible... yes
checking for sys/types.h... yes
checking for sys/stat.h... yes
checking for stdlib.h... yes
checking for string.h... yes
checking for memory.h... yes
checking for strings.h... yes
checking for inttypes.h... yes
checking for stdint.h... yes
checking for unistd.h... yes
checking fcntl.h usability... yes
checking fcntl.h presence... yes
checking for fcntl.h... yes
checking limits.h usability... yes
checking limits.h presence... yes
checking for limits.h... yes
checking for unistd.h... (cached) yes
checking zlib.h usability... yes
checking zlib.h presence... yes
checking for zlib.h... yes
checking whether byte ordering is bigendian... no
checking for short... yes
checking size of short... 2
checking for int... yes
checking size of int... 4
checking for long... yes
checking size of long... 8
checking for inline... inline
checking for mode_t... yes
checking build system type... x86_64-unknown-linux-gnu
checking host system type... x86_64-unknown-linux-gnu
checking for cos in -lm... yes
checking for strdup... yes
configure: creating ./config.status
config.status: creating Makefile
config.status: creating read/Makefile
config.status: creating progs/Makefile
config.status: creating config.h
config.status: executing depfiles commands
jitendra@jitendra-UNLOCK-INSTALL[io_lib-1.9.0] make []
make all-recursive
make[1]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0'
Making all in read
make[2]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0/read'
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT Read.o -MD -MP -MF ".deps/Read.Tpo" -c -o Read.o Read.c; \
then mv -f ".deps/Read.Tpo" ".deps/Read.Po"; else rm -f ".deps/Read.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT scf_extras.o -MD -MP -MF ".deps/scf_extras.Tpo" -c -o scf_extras.o scf_extras.c; \
then mv -f ".deps/scf_extras.Tpo" ".deps/scf_extras.Po"; else rm -f ".deps/scf_extras.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT translate.o -MD -MP -MF ".deps/translate.Tpo" -c -o translate.o translate.c; \
then mv -f ".deps/translate.Tpo" ".deps/translate.Po"; else rm -f ".deps/translate.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT compression.o -MD -MP -MF ".deps/compression.Tpo" -c -o compression.o `test -f '../ztr/compression.c' || echo './'`../ztr/compression.c; \
then mv -f ".deps/compression.Tpo" ".deps/compression.Po"; else rm -f ".deps/compression.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT ztr.o -MD -MP -MF ".deps/ztr.Tpo" -c -o ztr.o `test -f '../ztr/ztr.c' || echo './'`../ztr/ztr.c; \
then mv -f ".deps/ztr.Tpo" ".deps/ztr.Po"; else rm -f ".deps/ztr.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT ztr_translate.o -MD -MP -MF ".deps/ztr_translate.Tpo" -c -o ztr_translate.o `test -f '../ztr/ztr_translate.c' || echo './'`../ztr/ztr_translate.c; \
then mv -f ".deps/ztr_translate.Tpo" ".deps/ztr_translate.Po"; else rm -f ".deps/ztr_translate.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT fpoint.o -MD -MP -MF ".deps/fpoint.Tpo" -c -o fpoint.o `test -f '../abi/fpoint.c' || echo './'`../abi/fpoint.c; \
then mv -f ".deps/fpoint.Tpo" ".deps/fpoint.Po"; else rm -f ".deps/fpoint.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT seqIOABI.o -MD -MP -MF ".deps/seqIOABI.Tpo" -c -o seqIOABI.o `test -f '../abi/seqIOABI.c' || echo './'`../abi/seqIOABI.c; \
then mv -f ".deps/seqIOABI.Tpo" ".deps/seqIOABI.Po"; else rm -f ".deps/seqIOABI.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT seqIOALF.o -MD -MP -MF ".deps/seqIOALF.Tpo" -c -o seqIOALF.o `test -f '../alf/seqIOALF.c' || echo './'`../alf/seqIOALF.c; \
then mv -f ".deps/seqIOALF.Tpo" ".deps/seqIOALF.Po"; else rm -f ".deps/seqIOALF.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT ctfCompress.o -MD -MP -MF ".deps/ctfCompress.Tpo" -c -o ctfCompress.o `test -f '../ctf/ctfCompress.c' || echo './'`../ctf/ctfCompress.c; \
then mv -f ".deps/ctfCompress.Tpo" ".deps/ctfCompress.Po"; else rm -f ".deps/ctfCompress.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT seqIOCTF.o -MD -MP -MF ".deps/seqIOCTF.Tpo" -c -o seqIOCTF.o `test -f '../ctf/seqIOCTF.c' || echo './'`../ctf/seqIOCTF.c; \
then mv -f ".deps/seqIOCTF.Tpo" ".deps/seqIOCTF.Po"; else rm -f ".deps/seqIOCTF.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT expFileIO.o -MD -MP -MF ".deps/expFileIO.Tpo" -c -o expFileIO.o `test -f '../exp_file/expFileIO.c' || echo './'`../exp_file/expFileIO.c; \
then mv -f ".deps/expFileIO.Tpo" ".deps/expFileIO.Po"; else rm -f ".deps/expFileIO.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT seqIOPlain.o -MD -MP -MF ".deps/seqIOPlain.Tpo" -c -o seqIOPlain.o `test -f '../plain/seqIOPlain.c' || echo './'`../plain/seqIOPlain.c; \
then mv -f ".deps/seqIOPlain.Tpo" ".deps/seqIOPlain.Po"; else rm -f ".deps/seqIOPlain.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT misc_scf.o -MD -MP -MF ".deps/misc_scf.Tpo" -c -o misc_scf.o `test -f '../scf/misc_scf.c' || echo './'`../scf/misc_scf.c; \
then mv -f ".deps/misc_scf.Tpo" ".deps/misc_scf.Po"; else rm -f ".deps/misc_scf.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT read_scf.o -MD -MP -MF ".deps/read_scf.Tpo" -c -o read_scf.o `test -f '../scf/read_scf.c' || echo './'`../scf/read_scf.c; \
then mv -f ".deps/read_scf.Tpo" ".deps/read_scf.Po"; else rm -f ".deps/read_scf.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT write_scf.o -MD -MP -MF ".deps/write_scf.Tpo" -c -o write_scf.o `test -f '../scf/write_scf.c' || echo './'`../scf/write_scf.c; \
then mv -f ".deps/write_scf.Tpo" ".deps/write_scf.Po"; else rm -f ".deps/write_scf.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT array.o -MD -MP -MF ".deps/array.Tpo" -c -o array.o `test -f '../utils/array.c' || echo './'`../utils/array.c; \
then mv -f ".deps/array.Tpo" ".deps/array.Po"; else rm -f ".deps/array.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT compress.o -MD -MP -MF ".deps/compress.Tpo" -c -o compress.o `test -f '../utils/compress.c' || echo './'`../utils/compress.c; \
then mv -f ".deps/compress.Tpo" ".deps/compress.Po"; else rm -f ".deps/compress.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT error.o -MD -MP -MF ".deps/error.Tpo" -c -o error.o `test -f '../utils/error.c' || echo './'`../utils/error.c; \
then mv -f ".deps/error.Tpo" ".deps/error.Po"; else rm -f ".deps/error.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT files.o -MD -MP -MF ".deps/files.Tpo" -c -o files.o `test -f '../utils/files.c' || echo './'`../utils/files.c; \
then mv -f ".deps/files.Tpo" ".deps/files.Po"; else rm -f ".deps/files.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT find.o -MD -MP -MF ".deps/find.Tpo" -c -o find.o `test -f '../utils/find.c' || echo './'`../utils/find.c; \
then mv -f ".deps/find.Tpo" ".deps/find.Po"; else rm -f ".deps/find.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT mach-io.o -MD -MP -MF ".deps/mach-io.Tpo" -c -o mach-io.o `test -f '../utils/mach-io.c' || echo './'`../utils/mach-io.c; \
then mv -f ".deps/mach-io.Tpo" ".deps/mach-io.Po"; else rm -f ".deps/mach-io.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT open_trace_file.o -MD -MP -MF ".deps/open_trace_file.Tpo" -c -o open_trace_file.o `test -f '../utils/open_trace_file.c' || echo './'`../utils/open_trace_file.c; \
then mv -f ".deps/open_trace_file.Tpo" ".deps/open_trace_file.Po"; else rm -f ".deps/open_trace_file.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT read_alloc.o -MD -MP -MF ".deps/read_alloc.Tpo" -c -o read_alloc.o `test -f '../utils/read_alloc.c' || echo './'`../utils/read_alloc.c; \
then mv -f ".deps/read_alloc.Tpo" ".deps/read_alloc.Po"; else rm -f ".deps/read_alloc.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT strings.o -MD -MP -MF ".deps/strings.Tpo" -c -o strings.o `test -f '../utils/strings.c' || echo './'`../utils/strings.c; \
then mv -f ".deps/strings.Tpo" ".deps/strings.Po"; else rm -f ".deps/strings.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT traceType.o -MD -MP -MF ".deps/traceType.Tpo" -c -o traceType.o `test -f '../utils/traceType.c' || echo './'`../utils/traceType.c; \
then mv -f ".deps/traceType.Tpo" ".deps/traceType.Po"; else rm -f ".deps/traceType.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT xalloc.o -MD -MP -MF ".deps/xalloc.Tpo" -c -o xalloc.o `test -f '../utils/xalloc.c' || echo './'`../utils/xalloc.c; \
then mv -f ".deps/xalloc.Tpo" ".deps/xalloc.Po"; else rm -f ".deps/xalloc.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT vlen.o -MD -MP -MF ".deps/vlen.Tpo" -c -o vlen.o `test -f '../utils/vlen.c' || echo './'`../utils/vlen.c; \
then mv -f ".deps/vlen.Tpo" ".deps/vlen.Po"; else rm -f ".deps/vlen.Tpo"; exit 1; fi
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT hash_table.o -MD -MP -MF ".deps/hash_table.Tpo" -c -o hash_table.o `test -f '../utils/hash_table.c' || echo './'`../utils/hash_table.c; \
then mv -f ".deps/hash_table.Tpo" ".deps/hash_table.Po"; else rm -f ".deps/hash_table.Tpo"; exit 1; fi
../utils/hash_table.c: In function ‘HashFileOpen’:
../utils/hash_table.c:920:21: warning: field precision specifier ‘.*’ expects argument of type ‘int’, but argument 3 has type ‘long int’ [-Wformat=]
sprintf(aname, "%.*s%s", cp-fname+1, fname, hf->archive);
^
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../include -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT mFILE.o -MD -MP -MF ".deps/mFILE.Tpo" -c -o mFILE.o `test -f '../utils/mFILE.c' || echo './'`../utils/mFILE.c; \
then mv -f ".deps/mFILE.Tpo" ".deps/mFILE.Po"; else rm -f ".deps/mFILE.Tpo"; exit 1; fi
rm -f libread.a
ar cru libread.a Read.o scf_extras.o translate.o compression.o ztr.o ztr_translate.o fpoint.o seqIOABI.o seqIOALF.o ctfCompress.o seqIOCTF.o expFileIO.o seqIOPlain.o misc_scf.o read_scf.o write_scf.o array.o compress.o error.o files.o find.o mach-io.o open_trace_file.o read_alloc.o strings.o traceType.o xalloc.o vlen.o hash_table.o mFILE.o
ar: `u' modifier ignored since `D' is the default (see `U')
ranlib libread.a
make[2]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0/read'
Making all in progs
make[2]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0/progs'
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT convert_trace.o -MD -MP -MF ".deps/convert_trace.Tpo" -c -o convert_trace.o convert_trace.c; \
then mv -f ".deps/convert_trace.Tpo" ".deps/convert_trace.Po"; else rm -f ".deps/convert_trace.Tpo"; exit 1; fi
gcc -fPIC -o convert_trace convert_trace.o ../read/libread.a -lz -lm
../read/libread.a(open_trace_file.o): In function `find_file_url':
open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT makeSCF.o -MD -MP -MF ".deps/makeSCF.Tpo" -c -o makeSCF.o makeSCF.c; \
then mv -f ".deps/makeSCF.Tpo" ".deps/makeSCF.Po"; else rm -f ".deps/makeSCF.Tpo"; exit 1; fi
gcc -fPIC -o makeSCF makeSCF.o ../read/libread.a -lz -lm
../read/libread.a(open_trace_file.o): In function `find_file_url':
open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT extract_seq.o -MD -MP -MF ".deps/extract_seq.Tpo" -c -o extract_seq.o extract_seq.c; \
then mv -f ".deps/extract_seq.Tpo" ".deps/extract_seq.Po"; else rm -f ".deps/extract_seq.Tpo"; exit 1; fi
gcc -fPIC -o extract_seq extract_seq.o ../read/libread.a -lz -lm
../read/libread.a(open_trace_file.o): In function `find_file_url':
open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT index_tar.o -MD -MP -MF ".deps/index_tar.Tpo" -c -o index_tar.o index_tar.c; \
then mv -f ".deps/index_tar.Tpo" ".deps/index_tar.Po"; else rm -f ".deps/index_tar.Tpo"; exit 1; fi
gcc -fPIC -o index_tar index_tar.o
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT scf_dump.o -MD -MP -MF ".deps/scf_dump.Tpo" -c -o scf_dump.o scf_dump.c; \
then mv -f ".deps/scf_dump.Tpo" ".deps/scf_dump.Po"; else rm -f ".deps/scf_dump.Tpo"; exit 1; fi
gcc -fPIC -o scf_dump scf_dump.o ../read/libread.a -lz -lm
../read/libread.a(open_trace_file.o): In function `find_file_url':
open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT scf_info.o -MD -MP -MF ".deps/scf_info.Tpo" -c -o scf_info.o scf_info.c; \
then mv -f ".deps/scf_info.Tpo" ".deps/scf_info.Po"; else rm -f ".deps/scf_info.Tpo"; exit 1; fi
gcc -fPIC -o scf_info scf_info.o ../read/libread.a -lz -lm
../read/libread.a(open_trace_file.o): In function `find_file_url':
open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT scf_update.o -MD -MP -MF ".deps/scf_update.Tpo" -c -o scf_update.o scf_update.c; \
then mv -f ".deps/scf_update.Tpo" ".deps/scf_update.Po"; else rm -f ".deps/scf_update.Tpo"; exit 1; fi
gcc -fPIC -o scf_update scf_update.o ../read/libread.a -lz -lm
../read/libread.a(open_trace_file.o): In function `find_file_url':
open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT get_comment.o -MD -MP -MF ".deps/get_comment.Tpo" -c -o get_comment.o get_comment.c; \
then mv -f ".deps/get_comment.Tpo" ".deps/get_comment.Po"; else rm -f ".deps/get_comment.Tpo"; exit 1; fi
gcc -fPIC -o get_comment get_comment.o ../read/libread.a -lz -lm
../read/libread.a(open_trace_file.o): In function `find_file_url':
open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT hash_tar.o -MD -MP -MF ".deps/hash_tar.Tpo" -c -o hash_tar.o hash_tar.c; \
then mv -f ".deps/hash_tar.Tpo" ".deps/hash_tar.Po"; else rm -f ".deps/hash_tar.Tpo"; exit 1; fi
gcc -fPIC -o hash_tar hash_tar.o ../read/libread.a -lz -lm
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT hash_extract.o -MD -MP -MF ".deps/hash_extract.Tpo" -c -o hash_extract.o hash_extract.c; \
then mv -f ".deps/hash_extract.Tpo" ".deps/hash_extract.Po"; else rm -f ".deps/hash_extract.Tpo"; exit 1; fi
gcc -fPIC -o hash_extract hash_extract.o ../read/libread.a -lz -lm
if gcc -DHAVE_CONFIG_H -I. -I. -I.. -I.. -I../read -I../alf -I../abi -I../ctf -I../ztr -I../plain -I../scf -I../exp_file -I../utils -I/usr/local/include -fPIC -MT trace_dump.o -MD -MP -MF ".deps/trace_dump.Tpo" -c -o trace_dump.o trace_dump.c; \
then mv -f ".deps/trace_dump.Tpo" ".deps/trace_dump.Po"; else rm -f ".deps/trace_dump.Tpo"; exit 1; fi
gcc -fPIC -o trace_dump trace_dump.o ../read/libread.a -lz -lm
../read/libread.a(open_trace_file.o): In function `find_file_url':
open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'
make[2]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0/progs'
make[2]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0'
make[2]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0'
make[1]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0'

jitendra@jitendra-UNLOCK-INSTALL[io_lib-1.9.0] sudo make install []
[sudo] password for jitendra:
Making install in read
make[1]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0/read'
make[2]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0/read'
test -z "/usr/local/lib" || mkdir -p -- "/usr/local/lib"
/usr/bin/install -c -m 644 'libread.a' '/usr/local/lib/libread.a'
ranlib '/usr/local/lib/libread.a'
make[2]: Nothing to be done for 'install-data-am'.
make[2]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0/read'
make[1]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0/read'
Making install in progs
make[1]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0/progs'
make[2]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0/progs'
test -z "/usr/local/bin" || mkdir -p -- "/usr/local/bin"
/usr/bin/install -c 'convert_trace' '/usr/local/bin/convert_trace'
/usr/bin/install -c 'makeSCF' '/usr/local/bin/makeSCF'
/usr/bin/install -c 'extract_seq' '/usr/local/bin/extract_seq'
/usr/bin/install -c 'index_tar' '/usr/local/bin/index_tar'
/usr/bin/install -c 'scf_dump' '/usr/local/bin/scf_dump'
/usr/bin/install -c 'scf_info' '/usr/local/bin/scf_info'
/usr/bin/install -c 'scf_update' '/usr/local/bin/scf_update'
/usr/bin/install -c 'get_comment' '/usr/local/bin/get_comment'
/usr/bin/install -c 'hash_tar' '/usr/local/bin/hash_tar'
/usr/bin/install -c 'hash_extract' '/usr/local/bin/hash_extract'
/usr/bin/install -c 'trace_dump' '/usr/local/bin/trace_dump'
make[2]: Nothing to be done for 'install-data-am'.
make[2]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0/progs'
make[1]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0/progs'
make[1]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0'
make[2]: Entering directory '/home/jitendra/Downloads/io_lib-1.9.0'
make[2]: Nothing to be done for 'install-exec-am'.
test -z "/usr/local/man/man3" || mkdir -p -- "/usr/local/man/man3"
/usr/bin/install -c -m 644 './man/man3/exp2read.3' '/usr/local/man/man3/exp2read.3'
/usr/bin/install -c -m 644 './man/man3/ExperimentFile.3' '/usr/local/man/man3/ExperimentFile.3'
/usr/bin/install -c -m 644 './man/man3/fread_reading.3' '/usr/local/man/man3/fread_reading.3'
/usr/bin/install -c -m 644 './man/man3/fread_scf.3' '/usr/local/man/man3/fread_scf.3'
/usr/bin/install -c -m 644 './man/man3/fwrite_reading.3' '/usr/local/man/man3/fwrite_reading.3'
/usr/bin/install -c -m 644 './man/man3/fwrite_scf.3' '/usr/local/man/man3/fwrite_scf.3'
/usr/bin/install -c -m 644 './man/man3/read2exp.3' '/usr/local/man/man3/read2exp.3'
/usr/bin/install -c -m 644 './man/man3/read2scf.3' '/usr/local/man/man3/read2scf.3'
/usr/bin/install -c -m 644 './man/man3/read_allocate.3' '/usr/local/man/man3/read_allocate.3'
/usr/bin/install -c -m 644 './man/man3/read_deallocate.3' '/usr/local/man/man3/read_deallocate.3'
/usr/bin/install -c -m 644 './man/man3/read_reading.3' '/usr/local/man/man3/read_reading.3'
/usr/bin/install -c -m 644 './man/man3/read_scf.3' '/usr/local/man/man3/read_scf.3'
/usr/bin/install -c -m 644 './man/man3/read_scf_header.3' '/usr/local/man/man3/read_scf_header.3'
/usr/bin/install -c -m 644 './man/man3/scf2read.3' '/usr/local/man/man3/scf2read.3'
/usr/bin/install -c -m 644 './man/man3/write_reading.3' '/usr/local/man/man3/write_reading.3'
/usr/bin/install -c -m 644 './man/man3/write_scf.3' '/usr/local/man/man3/write_scf.3'
/usr/bin/install -c -m 644 './man/man3/write_scf_header.3' '/usr/local/man/man3/write_scf_header.3'
test -z "/usr/local/man/man4" || mkdir -p -- "/usr/local/man/man4"
/usr/bin/install -c -m 644 './man/man4/Read.4' '/usr/local/man/man4/Read.4'
test -z "/usr/local/include/io_lib" || mkdir -p -- "/usr/local/include/io_lib"
/usr/bin/install -c -m 644 'read/Read.h' '/usr/local/include/io_lib/Read.h'
/usr/bin/install -c -m 644 'read/scf_extras.h' '/usr/local/include/io_lib/scf_extras.h'
/usr/bin/install -c -m 644 'read/translate.h' '/usr/local/include/io_lib/translate.h'
/usr/bin/install -c -m 644 'abi/abi.h' '/usr/local/include/io_lib/abi.h'
/usr/bin/install -c -m 644 'abi/fpoint.h' '/usr/local/include/io_lib/fpoint.h'
/usr/bin/install -c -m 644 'abi/seqIOABI.h' '/usr/local/include/io_lib/seqIOABI.h'
/usr/bin/install -c -m 644 'alf/alf.h' '/usr/local/include/io_lib/alf.h'
/usr/bin/install -c -m 644 'ctf/seqIOCTF.h' '/usr/local/include/io_lib/seqIOCTF.h'
/usr/bin/install -c -m 644 'exp_file/expFileIO.h' '/usr/local/include/io_lib/expFileIO.h'
/usr/bin/install -c -m 644 'plain/plain.h' '/usr/local/include/io_lib/plain.h'
/usr/bin/install -c -m 644 'scf/scf.h' '/usr/local/include/io_lib/scf.h'
/usr/bin/install -c -m 644 'utils/array.h' '/usr/local/include/io_lib/array.h'
/usr/bin/install -c -m 644 'utils/compress.h' '/usr/local/include/io_lib/compress.h'
/usr/bin/install -c -m 644 'utils/error.h' '/usr/local/include/io_lib/error.h'
/usr/bin/install -c -m 644 'utils/mach-io.h' '/usr/local/include/io_lib/mach-io.h'
/usr/bin/install -c -m 644 'utils/misc.h' '/usr/local/include/io_lib/misc.h'
/usr/bin/install -c -m 644 'utils/open_trace_file.h' '/usr/local/include/io_lib/open_trace_file.h'
/usr/bin/install -c -m 644 'utils/tar_format.h' '/usr/local/include/io_lib/tar_format.h'
/usr/bin/install -c -m 644 'utils/traceType.h' '/usr/local/include/io_lib/traceType.h'
/usr/bin/install -c -m 644 'utils/xalloc.h' '/usr/local/include/io_lib/xalloc.h'
/usr/bin/install -c -m 644 'utils/mFILE.h' '/usr/local/include/io_lib/mFILE.h'
/usr/bin/install -c -m 644 'utils/stdio_hack.h' '/usr/local/include/io_lib/stdio_hack.h'
/usr/bin/install -c -m 644 'utils/vlen.h' '/usr/local/include/io_lib/vlen.h'
/usr/bin/install -c -m 644 'utils/hash_table.h' '/usr/local/include/io_lib/hash_table.h'
/usr/bin/install -c -m 644 'utils/os.h' '/usr/local/include/io_lib/os.h'
/usr/bin/install -c -m 644 'ztr/compression.h' '/usr/local/include/io_lib/compression.h'
/usr/bin/install -c -m 644 'ztr/ztr.h' '/usr/local/include/io_lib/ztr.h'
make[2]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0'
make[1]: Leaving directory '/home/jitendra/Downloads/io_lib-1.9.0'

3. Now install Bio::SCF

Now follows these steps:

tar zxf Bio::SCF.tar
cd Bio::SCF
perl Makefile.PL
make
make test
make install

jitendra@jitendra-UNLOCK-INSTALL[Bio-SCF-1.01] perl Makefile.PL []
Checking if your kit is complete...
Looks good
Generating a Unix-style Makefile
Writing Makefile for Bio::SCF
Writing MYMETA.yml and MYMETA.json
jitendra@jitendra-UNLOCK-INSTALL[Bio-SCF-1.01] make []
cp SCF.pm blib/lib/Bio/SCF.pm
cp SCF/Arrays.pm blib/lib/Bio/SCF/Arrays.pm
Running Mkbootstrap for Bio::SCF ()
chmod 644 "SCF.bs"
"/usr/bin/perl" "/usr/share/perl/5.22/ExtUtils/xsubpp" -typemap "/usr/share/perl/5.22/ExtUtils/typemap" SCF.xs > SCF.xsc && mv SCF.xsc SCF.c
Please specify prototyping behavior for SCF.xs (see perlxs manual)
x86_64-linux-gnu-gcc -c -D_REENTRANT -D_GNU_SOURCE -DDEBIAN -fwrapv -fno-strict-aliasing -pipe -I/usr/local/include -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -O2 -g -DVERSION=\"1.01\" -DXS_VERSION=\"1.01\" -fPIC "-I/usr/lib/x86_64-linux-gnu/perl/5.22/CORE" -DLITTLE_ENDIAN SCF.c
In file included from /usr/lib/x86_64-linux-gnu/perl/5.22/CORE/perl.h:5546:0,
from SCF.xs:5:
SCF.xs: In function ‘XS_Bio__SCF_get_scf_pointer’:
SCF.xs:57:20: warning: cast from pointer to integer of different size [-Wpointer-to-int-cast]
ret_val = newSViv((int)scf_data);
^
/usr/lib/x86_64-linux-gnu/perl/5.22/CORE/embed.h:402:40: note: in definition of macro ‘newSViv’
#define newSViv(a) Perl_newSViv(aTHX_ a)
^
SCF.xs: In function ‘XS_Bio__SCF_get_scf_fpointer’:
SCF.xs:80:20: warning: cast from pointer to integer of different size [-Wpointer-to-int-cast]
ret_val = newSViv((int)scf_data);
^
/usr/lib/x86_64-linux-gnu/perl/5.22/CORE/embed.h:402:40: note: in definition of macro ‘newSViv’
#define newSViv(a) Perl_newSViv(aTHX_ a)
^
SCF.xs: In function ‘XS_Bio__SCF_scf_free’:
SCF.xs:89:17: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]
scf_deallocate((Scf *)scf_pointer);
^
SCF.xs: In function ‘XS_Bio__SCF_get_comments’:
SCF.xs:95:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]
Scf *scf_data = (Scf *)scf_pointer;
^
SCF.xs: In function ‘XS_Bio__SCF_set_comments’:
SCF.xs:108:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]
Scf *scf_data = (Scf *)scf_pointer;
^
SCF.xs: In function ‘XS_Bio__SCF_scf_write’:
SCF.xs:121:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]
Scf *scf_data = (Scf *)scf_pointer;
^
SCF.xs: In function ‘XS_Bio__SCF_scf_fwrite’:
SCF.xs:137:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]
Scf *scf_data = (Scf *)scf_pointer;
^
SCF.xs: In function ‘XS_Bio__SCF_get_from_header’:
SCF.xs:159:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]
Scf *scf_data = (Scf *)scf_pointer;
^
SCF.xs: In function ‘XS_Bio__SCF_get_at’:
SCF.xs:186:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]
Scf *scf_data = (Scf *)scf_pointer;
^
SCF.xs: In function ‘XS_Bio__SCF_set_base_at’:
SCF.xs:242:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]
Scf *scf_data = (Scf *)scf_pointer;
^
SCF.xs: In function ‘XS_Bio__SCF_set_at’:
SCF.xs:255:18: warning: cast to pointer from integer of different size [-Wint-to-pointer-cast]
Scf *scf_data = (Scf *)scf_pointer;
^
rm -f blib/arch/auto/Bio/SCF/SCF.so
x86_64-linux-gnu-gcc -shared -L/usr/local/lib -fstack-protector-strong SCF.o -o blib/arch/auto/Bio/SCF/SCF.so \
-lread -lz \

/usr/local/lib/libread.a(open_trace_file.o): In function `find_file_url':
open_trace_file.c:(.text+0xaf4): warning: the use of `tempnam' is dangerous, better use `mkstemp'
chmod 755 blib/arch/auto/Bio/SCF/SCF.so
"/usr/bin/perl" -MExtUtils::Command::MM -e 'cp_nonempty' -- SCF.bs blib/arch/auto/Bio/SCF/SCF.bs 644
Manifying 1 pod document

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Can't locate XML/parser.pm in @INC (@INC contains:
/usr/lib/perl5/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/5.10.0
/usr/local/lib/perl5/site_perl/5.10.0/i386-linux-thread-multi
/usr/local/lib/perl5/site_perl/5.10.0
/usr/lib/perl5/vendor_perl/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.10.0 /usr/lib/perl5/vendor_perl
/usr/lib/perl5/site_perl/5.10.0 .)

Manual Method of Perl Module Installation

• Install Perl Modules Manually

This manual method is very useful when your computer or server is not connected to the Internet.

Download Perl module:
Go to CPAN Search website and search for the module that you wish to download. In this example, let us search, download and install XML::Parser Perl module. I have downloaded the XML-Parser-2.36.tar.gz to /home/download

# cd /home/download
# gzip -d XML-Parser-2.36.tar.gz
# tar xvf XML-Parser-2.36.tar
# cd XML-Parser-2.36

Build the perl module:
Build by running Makefile.PL, remember the case sensitivity, make and make test.

# perl Makefile.PL
Checking if your kit is complete...
Looks good
Writing Makefile for XML::Parser::Expat
Writing Makefile for XML::Parser
# make
# make test

Install the perl module:
Now your package is ready to install.

# make install

As a newbie it looks pretty simple, and one go. But, luckily this is a very simple one module with no dependencies. Typically, Perl modules will be dependent on several other modules. Just imagine chasing all these dependencies one-by-one, thinking ... oh ye I got it. That will be very painful and annoying task. I recommend the CPAN method of installation as shown below.

Install Perl Modules using CPAN automatically

Logically, you should must have the CPAN perl module installed in your server or computer before you can install any other Perl modules using CPAN. I know you  are laughing, "to install a perl module you need another perl module"  ;)

Lets verify whether CPAN is already installed:

To install Perl modules using CPAN, make sure the cpan command is working. Following are the error message when CPAN module is not installed.

# cpan
-bash: cpan: command not found

# perl -MCPAN -e shell
Can't locate CPAN.pm in @INC (@INC contains:
/usr/lib/perl5/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/5.10.0
/usr/local/lib/perl5/site_perl/5.10.0/i386-linux-thread-multi
/usr/local/lib/perl5/site_perl/5.10.0
/usr/lib/perl5/vendor_perl/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.10.0
/usr/lib/perl5/vendor_perl /usr/lib/perl5/site_perl/5.10.0 .).
BEGIN failed--compilation aborted.

Install the CPAN module using yum:
If CPAN in not installed in your system, you can use "yum" for the rescue. Dont worry biological data cruncher, this is true we are now dependent all these tiny magicians :).

# yum install perl-CPAN

Output of yum install perl-CPAN command:

Loaded plugins: refresh-packagekit
updates-newkey                       | 2.3 kB     00:00
primary.sqlite.bz2                   | 2.4 MB     00:00
Setting up Install Process
Parsing package install arguments

Resolving Dependencies
Transaction Summary
=============================================================================
Install      5 Package(s)
Update       0 Package(s)
Remove       0 Package(s)

Total download size: 1.0 M
Is this ok [y/N]: y
Downloading Packages:
(1/5): perl-ExtUtils-ParseXS-2.18-31.fc9.i386.rpm     |  30 kB     00:00
(2/5): perl-Test-Harness-2.64-31.fc9.i386.rpm         |  70 kB     00:00
(3/5): perl-CPAN-1.9205-31.fc9.i386.rpm               | 217 kB     00:00
(4/5): perl-ExtUtils-MakeMaker-6.36-31.fc9.i386.rpm   | 284 kB     00:00
(5/5): perl-devel-5.10.0-31.fc9.i386.rpm              | 408 kB     00:00

Installing     : perl-ExtUtils-ParseXS                             [1/5]
Installing     : perl-devel                                        [2/5]
Installing     : perl-Test-Harness                                 [3/5]
Installing     : perl-ExtUtils-MakeMaker                           [4/5]
Installing     : perl-CPAN                                         [5/5]


Installed: perl-CPAN.i386 0:1.9205-31.fc9
Dependency Installed:
  perl-ExtUtils-MakeMaker.i386 0:6.36-31.fc9
  perl-ExtUtils-ParseXS.i386 1:2.18-31.fc9
  perl-Test-Harness.i386 0:2.64-31.fc9
  perl-devel.i386 4:5.10.0-31.fc9
Complete!

Configure cpan the first time:
Once the CPAN is installed, you need to configure it by executing cpan, you should set some configuration parameters as shown below. I have shown only the important configuration parameters below. Accept all the default values by pressing enter.

Note: Make sure to execute “o conf commit” in the cpan prompt after the configuration to save the settings.

# cpan

Sorry, we have to rerun the configuration dialog for CPAN.pm due
to some missing parameters...

CPAN build and cache directory? [/root/.cpan]
Download target directory? [/root/.cpan/sources]
Directory where the build process takes place? [/root/.cpan/build]

Always commit changes to config variables to disk? [no]
Cache size for build directory (in MB)? [100]
Let the index expire after how many days? [1]

Perform cache scanning (atstart or never)? [atstart]
Cache metadata (yes/no)? [yes]
Policy on building prerequisites (follow, ask or ignore)? [ask]

Parameters for the 'perl Makefile.PL' command? []
Parameters for the 'perl Build.PL' command? []

Your ftp_proxy? []
Your http_proxy? []
Your no_proxy? []
Is it OK to try to connect to the Internet? [yes]

First, pick a nearby continent and country by typing in the number(s)
(1) Africa
(2) Asia
(3) Central America
(4) Europe
(5) North America
(6) Oceania
(7) South America
Select your continent (or several nearby continents) [] 5

(1) Bahamas
(2) Canada
(3) Mexico
(4) United States
Select your country (or several nearby countries) [] 4

(2) ftp://carroll.cac.psu.edu/pub/CPAN/
(3) ftp://cpan-du.viaverio.com/pub/CPAN/
(4) ftp://cpan-sj.viaverio.com/pub/CPAN/
(5) ftp://cpan.calvin.edu/pub/CPAN
(6) ftp://cpan.cs.utah.edu/pub/CPAN/
e.g. '1 4 5' or '7 1-4 8' [] 2-16

cpan[1]> o conf commit
commit: wrote '/usr/lib/perl5/5.10.0/CPAN/Config.pm'

cpan[2]> quit
No history written (no histfile specified).
Lockfile removed.

• Install Perl Modules using CPAN

Hey smile please, now you are ready with CPAN and can download modules in one line command.

You can use one of the following method to install a Perl module using cpan:

# perl -MCPAN -e 'install Bundle::BioPerl'

(or)

# cpan
cpan shell -- CPAN exploration and modules installation (v1.9205)
ReadLine support available (maybe install Bundle::CPAN or Bundle::CPANxxl?)

cpan[1]> install "Bundle::BioPerl"

In the example above, CPAN will check for Bundle::BioPerl dependencies and automatically resolves and installs Bundle::BioPerl with all the dependent Perl modules.

• Quick Ways

Oh, look at your face.. smily hmm :). This is what your are looking for, a quick and best way to install Perl modules, Bioperl. Following are the the steps to download BioPerl in your server/computer.

# sudo apt-cache search perl BioPerl

Output will be like as follows:

bioperl - Perl tools for computational molecular biology
bioperl-run - BioPerl wrappers: scripts
libbio-perl-perl - BioPerl core perl modules
libbio-perl-run-perl - BioPerl wrappers: modules
libbio-samtools-perl - Perl interface to SamTools library for DNA sequencing
libbiojava-java - Java API to biological data and applications (default version)
libbiojava3-java - Java API to biological data and applications (default version)
python-biopython-sql - Biopython support for the BioSQL database schema
libbtlib-perl - library for basic sequence manipulation

# sudo apt-get install bioperl

If it is installed then flash the following message:

Reading package lists... Done
Building dependency tree      
Reading state information... Done
bioperl is already the newest version.
0 upgraded, 0 newly installed, 0 to remove and 10 not upgraded.

In it is found not installed in your server or system them install all with dependencies.

You can use the same approach to install all the modules, and packages if required.

Thanks for reading. Best of luck for your research.

http://ritg.med.harvard.edu/training/perl/RC_Perl_Intro.pdf

I google it and found that Strawberry comes with additional dev tools to compile CPAN modules if necessary. Whereas ActivePerl has a lot of prepackaged modules which are easier to install with PPM. In addition, DWIM Perl contains the standard Perl and a lot of extension and Citrus Perl is a binary distribution of Perl created for GUI application developers. 

Now, I wonder what should I pick to get started? 

Note: I am going to use BioPerl in near future.

http://dwimperl.com/

http://www.activestate.com/activeperl

http://www.citrusperl.com/

http://strawberryperl.com/