<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/37610?offset=240</link>
	<atom:link href="https://bioinformaticsonline.com/related/37610?offset=240" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	
<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/7999/senior-research-fellow-indian-agricultural-statistics-research-institute</guid>
  <pubDate>Thu, 23 Jan 2014 06:22:15 -0600</pubDate>
  <link></link>
  <title><![CDATA[Senior Research Fellow @ Indian Agricultural Statistics Research Institute]]></title>
  <description><![CDATA[
<p>Indian Agricultural Statistics Research Institute<br />Library Avenue, Pusa, New Delhi – 110012</p>

<p>Walk-in-Interview</p>

<p>Walk-in-interview will be held on February 11, 2014 at 10:00 A.M. at IASRI, New Delhi for a project “Whole Genome Sequencing and Development of Allied Genomics Resources in Two Commercially Important Fish-Labeo rohita and Clarias batrachus” funded by Department of Biotechnology, Ministry of Science and Technology, Government of India, New Delhi for the following posts. The appointment will be on contractual basis upto September, 2016 or till the termination of the project whichever is earlier and the incumbent shall not have any claim for regular appointment under ICAR.</p>

<p>Senior Research Fellow Two</p>

<p>Post-Graduation in Bioinformatics/ Agricultural Statistics/ Statistics/ Computer Science/ Computer Application/ Biotechnology or equivalent with 1st Division</p>

<p> Knowledge of Statistical Analysis /Bioinformatics tools/computer programming for computational genomics.</p>

<p>Emoluments for Research Associate: Consolidated Rs: 16000/- per month + 30% HRA (1st Two years) and Rs: 18000/- per month + 30% HRA (3rd Year)</p>

<p>Age Limit: Age should be not more than 35 years (5 years relaxation for SC/ST/women candidates and 3 years for OBC candidates as on date of interview).<br />Interested candidates are requested to appear for Walk-in-Interview on the date and time as specified above in Room No. 106, Training Cum Administrative Block of the Institute along with their application giving bio-data with attested copies of certificates, degrees, testimonials, etc. and one passport size photograph. Original certificates/ Degrees are needed to be produced at the time of interview. No T.A. /D.A. will be paid for appearing in the interview.</p>

<p>Advertisement: http://www.iasri.res.in/employment/2014/srf_cabin.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/17885/international-conference-on-bioinformatics-models-methods-and-algorithms</guid>
	<pubDate>Sun, 05 Oct 2014 11:42:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/17885/international-conference-on-bioinformatics-models-methods-and-algorithms</link>
	<title><![CDATA[International Conference on Bioinformatics Models, Methods and Algorithms]]></title>
	<description><![CDATA[<p><span>The purpose of the International Conference on Bioinformatics Models, Methods and Algorithms is to bring together researchers and practitioners interested in the application of computational systems and information technologies to the field of molecular biology, including for example the use of statistics and algorithms to understanding biological processes and systems, with a focus on new developments in genome bioinformatics and computational biology. Areas of interest for this community include sequence analysis, biostatistics, image analysis, scientific data management and data mining, machine learning, pattern recognition, computational evolutionary biology, computational genomics and other related fields.</span></p>
<p><span><span>Position Paper Submission Extension:</span><span>&nbsp;</span><span>October 9, 2014</span><span>&nbsp;</span><br><span>Regular Paper Authors Notification:</span><span>&nbsp;</span><span>November 3, 2014</span><span>&nbsp;</span><br><span>Position Paper Authors Notification:</span><span>&nbsp;</span><span>November 6, 2014</span><span>&nbsp;</span><br><span>Regular and Position Paper Camera Ready and Registration:</span><span>&nbsp;</span><span>November 17, 2014</span><span>&nbsp;</span></span></p><p>Address of the bookmark: <a href="http://www.bioinformatics.biostec.org/" rel="nofollow">http://www.bioinformatics.biostec.org/</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8108/jrf-institute-of-cytology-preventive-oncology</guid>
  <pubDate>Sat, 01 Feb 2014 13:47:29 -0600</pubDate>
  <link></link>
  <title><![CDATA[JRF @ Institute of Cytology &amp; Preventive Oncology]]></title>
  <description><![CDATA[
<p>Institute of Cytology &amp; Preventive Oncology (ICPO) which was initially established as Cytology Research Centre ( CRC ) by the Indian Council of Medical Research (ICMR) in 1979, came into the existence in 1989 when CRC was elevated to the level of Institute. ICPO was instituted with the main aim of promoting research in the field of cancers that are most prevalent in India with an emphasis on their early detection and prevention.</p>

<p>Candidates having the below mentioned qualifications may appear for Walk in Interview at ICPO on 5th Feb 2014 between 10.00 AM and 12.00 PM under the NIF project entitled "Prediction of drug tragets of chemical constituents present within non-codified medicinal plants" under Dr Subhash M.Agarwal, Scientist C</p>

<p>    Position : JRF<br />    No of Post : One<br />    Pay : Rs 12000/- + 30% HRA </p>

<p>    Desired Profile : M.Sc in Bioinformatics with good academic record. Candidate with experience in database development and scripting would be preferred<br />    Age Limit : Below 28 years<br />    Period : 2 months</p>

<p>Interested candidates may send their applications with bio-data by email (smagarwal@gmail.com) or post addressed to Dr Subhash M Agarwal, Scientist C, Bioinformatics Division, Institute of Cytology and Preventive Oncology (ICPO) I-7, Sector 39, Noida-201301 so as to reach latest by 04.02.14</p>

<p>Deadline : 04.02.14</p>

<p>http://icmr.nic.in/icmrnews/icpo_jrf.pdf</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/42974/list-of-bioinformatics-packages-for-ngs-analysis</guid>
	<pubDate>Sat, 20 Mar 2021 00:28:51 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/42974/list-of-bioinformatics-packages-for-ngs-analysis</link>
	<title><![CDATA[List of bioinformatics packages for NGS analysis !]]></title>
	<description><![CDATA[<p>Package suites gather software packages and installation tools for specific languages or platforms. We have some for bioinformatics software.</p><ul>
<li><a href="https://github.com/Bioconductor">Bioconductor</a>&nbsp;&ndash; A plethora of tools for analysis and comprehension of high-throughput genomic data, including 1500+ software packages. [&nbsp;<a href="https://link.springer.com/article/10.1186/gb-2004-5-10-r80">paper-2004</a>&nbsp;|&nbsp;<a href="https://www.bioconductor.org/">web</a>&nbsp;]</li>
<li><a href="https://github.com/biopython/biopython">Biopython</a>&nbsp;&ndash; Freely available tools for biological computing in Python, with included cookbook, packaging and thorough documentation. Part of the&nbsp;<a href="http://open-bio.org/">Open Bioinformatics Foundation</a>. Contains the very useful&nbsp;<a href="https://biopython.org/DIST/docs/api/Bio.Entrez-module.html">Entrez</a>&nbsp;package for API access to the NCBI databases. [&nbsp;<a href="https://pubmed.ncbi.nlm.nih.gov/19304878">paper-2009</a>&nbsp;|&nbsp;<a href="https://biopython.org/">web</a>&nbsp;]</li>
<li><a href="https://github.com/bioconda">Bioconda</a>&nbsp;&ndash; A channel for the&nbsp;<a href="http://conda.pydata.org/docs/intro.html">conda package manager</a>&nbsp;specializing in bioinformatics software. Includes a repository with 3000+ ready-to-install (with&nbsp;<code>conda install</code>) bioinformatics packages. [&nbsp;<a href="https://pubmed.ncbi.nlm.nih.gov/29967506">paper-2018</a>&nbsp;|&nbsp;<a href="https://bioconda.github.io/">web</a>&nbsp;]</li>
<li><a href="https://github.com/BioJulia">BioJulia</a>&nbsp;&ndash; Bioinformatics and computational biology infastructure for the Julia programming language. [&nbsp;<a href="https://biojulia.net/">web</a>&nbsp;]</li>
<li><a href="https://github.com/rust-bio/rust-bio">Rust-Bio</a>&nbsp;&ndash; Rust implementations of algorithms and data structures useful for bioinformatics. [&nbsp;<a href="http://bioinformatics.oxfordjournals.org/content/early/2015/10/06/bioinformatics.btv573.short?rss=1">paper-2016</a>&nbsp;]</li>
<li><a href="https://github.com/seqan/seqan3">SeqAn</a>&nbsp;&ndash; The modern C++ library for sequence analysis.</li>
</ul>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/8385/peng-lab</guid>
  <pubDate>Tue, 18 Feb 2014 13:53:46 -0600</pubDate>
  <link></link>
  <title><![CDATA[Peng Lab]]></title>
  <description><![CDATA[
<p>Peng Lab at Janelia Farm Research Campus, Howard Hughes Medical Institute focuses on data mining for bioinformatics and computational molecular biology, particularly, bioimage data mining and informatics. These bioimages include cellular and molecular images and related medical images. </p>

<p>* Analysis of Gene Expression Pattern Images: high-performance image analysis and mining for different model organisms, such as fruitfly, C. elegans, and mouse;<br />* Feature/Model Learning: developing algorithms and software</p>

<p>Location :Janelia Farm Research Campus, Howard Hughes Medical Institute, Ashburn, Virginia, USA.</p>

<p>http://research.janelia.org/peng/</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/23121/senior-sas-programmer-urgent-role-permanant-welwyn-garden-city-uk</guid>
  <pubDate>Fri, 03 Jul 2015 08:14:23 -0500</pubDate>
  <link></link>
  <title><![CDATA[Senior SAS Programmer - URGENT ROLE - Permanant - Welwyn Garden City - UK]]></title>
  <description><![CDATA[
<p>SAS Programmer URGENTLY required !! My client is looking for an experienced Senior SAS Programmer, to join their bubbly dynamic team in Welwyn Garden City. You must have experience within SAS and/or R programming language. I am looking for someone with a background within either Life Sciences, Statistics, Computer Science, Bioinformatics etc. I am looking for someone with leadership qualities, you must have excellent analyst skills. Please call Dareen Evans on 01772 278050 or email your cv to dareen.evans@itworkshealth.co.uk</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8442/assistant-professor-king-saud-university-riyadh</guid>
  <pubDate>Fri, 21 Feb 2014 05:57:18 -0600</pubDate>
  <link></link>
  <title><![CDATA[Assistant Professor @ King Saud University Riyadh]]></title>
  <description><![CDATA[
<p>Qualifications: Candidates must have a Ph.D. and a strong background in Molecular and Cellular Biology, protein expression, FACS, or computational biology, and ability to work collaboratively.</p>

<p>This position will have a significant focus on providing analytical support for next generation sequencing data analysis – Exome-sequencing, Targetted sequencing as well as high-throughput genotyping on Illumina platform.</p>

<p>Job location:</p>

<p>Genome Research Chair<br />King Saud University, Riyadh-11451<br />KSA</p>

<p>Interested candidate may forward their CV to grcksu@gmail.com</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</guid>
	<pubDate>Thu, 07 Dec 2017 08:46:51 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34552/edit-distance-application-in-bioinformatics</link>
	<title><![CDATA[Edit distance application in bioinformatics !]]></title>
	<description><![CDATA[<p>There are other popular measures of&nbsp;<a href="https://en.wikipedia.org/wiki/Edit_distance" title="Edit distance">edit distance</a>, which are calculated using a different set of allowable edit operations. For instance,</p><ul>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Damerau%E2%80%93Levenshtein_distance" title="Damerau&ndash;Levenshtein distance">Damerau&ndash;Levenshtein distance</a>&nbsp;allows insertion, deletion, substitution, and the&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>&nbsp;of two adjacent characters;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Longest_common_subsequence_problem" title="Longest common subsequence problem">longest common subsequence</a>&nbsp;(LCS) distance allows only insertion and deletion, not substitution;</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Hamming_distance" title="Hamming distance">Hamming distance</a>&nbsp;allows only substitution, hence, it only applies to strings of the same length.</li>
<li>the&nbsp;<a href="https://en.wikipedia.org/wiki/Jaro_distance" title="Jaro distance">Jaro distance</a>&nbsp;allows only&nbsp;<a href="https://en.wikipedia.org/wiki/Transposition_(mathematics)" title="Transposition (mathematics)">transposition</a>.</li>
</ul><p>&nbsp;</p><pre><span>use</span> Text<span>::</span>Levenshtein <span>qw</span><span>(</span>distance<span>);</span>

 <span>print</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>"four"</span><span>);</span>
 <span># prints "2"</span>

 <span>my</span> <span>@words</span>     <span>=</span> <span>qw</span><span>/ four foo bar /</span><span>;</span>
 <span>my</span> <span>@distances</span> <span>=</span> <span>distance</span><span>(</span><span>"foo"</span><span>,</span><span>@words</span><span>);</span>

 <span>print</span> <span>"@distances"</span><span>;</span>
 <span># prints "2 0 3"</span><br /><br /><br /></pre><pre><span>use</span> Algorithm<span>::</span>LCSS <span>qw</span><span>(</span> LCSS CSS CSS_Sorted <span>);</span>
    <span>my</span> <span>$lcss_ary_ref</span> <span>=</span> <span>LCSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array</span>
    <span>my</span> <span>$lcss_string</span>  <span>=</span> <span>LCSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># string</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>    <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>      <span># ref to array of strings</span>
    <span>my</span> <span>$css_ary_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>\</span><span>@SEQ1</span><span>,</span> <span>\</span><span>@SEQ2</span> <span>);</span>  <span># ref to array of arrays</span>
    <span>my</span> <span>$css_str_ref</span> <span>=</span> <span>CSS_Sorted</span><span>(</span> <span>$STR1</span><span>,</span> <span>$STR2</span> <span>);</span>    <span># ref to array of strings<br /><br /><br /><br /></span></pre><p>There are many different modules on CPAN for calculating the edit distance between two strings. Here's just a selection.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshteinXS">Text::LevenshteinXS</a>&nbsp;and&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3AXS">Text::Levenshtein::XS</a>&nbsp;are both versions of the Levenshtein algorithm that require a C compiler, but will be a lot faster than this module.</p><p>The Damerau-Levenshtein edit distance is like the Levenshtein distance, but in addition to insertion, deletion and substitution, it also considers the transposition of two adjacent characters to be a single edit. The module&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau">Text::Levenshtein::Damerau</a>&nbsp;defaults to using a pure perl implementation, but if you've installed&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3ALevenshtein%3A%3ADamerau%3A%3AXS">Text::Levenshtein::Damerau::XS</a>&nbsp;then it will be a lot quicker.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AWagnerFischer">Text::WagnerFischer</a>&nbsp;is an implementation of the Wagner-Fischer edit distance, which is similar to the Levenshtein, but applies different weights to each edit type.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ABrew">Text::Brew</a>&nbsp;is an implementation of the Brew edit distance, which is another algorithm based on edit weights.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy">Text::Fuzzy</a>&nbsp;provides a number of operations for partial or fuzzy matching of text based on edit distance.&nbsp;<a href="http://search.cpan.org/perldoc?Text%3A%3AFuzzy%3A%3APP">Text::Fuzzy::PP</a>&nbsp;is a pure perl implementation of the same interface.</p><p><a href="http://search.cpan.org/perldoc?String%3A%3ASimilarity">String::Similarity</a>&nbsp;takes two strings and returns a value between 0 (meaning entirely different) and 1 (meaning identical). Apparently based on edit distance.</p><p><a href="http://search.cpan.org/perldoc?Text%3A%3ADice">Text::Dice</a>&nbsp;calculates&nbsp;<a href="https://en.wikipedia.org/wiki/S%C3%B8rensen%E2%80%93Dice_coefficient">Dice's coefficient</a>&nbsp;for two strings. This formula was originally developed to measure the similarity of two different populations in ecological research.</p><pre><span>&nbsp;</span></pre>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/8466/srf-position-in-computational-systems-biology-computational-biology-group-iiit-delhi</guid>
  <pubDate>Sun, 23 Feb 2014 20:56:08 -0600</pubDate>
  <link></link>
  <title><![CDATA[SRF position in Computational Systems Biology Computational biology Group, IIIT-Delhi]]></title>
  <description><![CDATA[
<p>An opportunity to perform research in DST supported project that involves building of mathematical models to understand the functional relationship between circadian rhythms and memory formation under stressful condition.  In this project, mathematical model of circadian rhythms based on gene regulatory mechanisms will be unified with the mathematical model of calcium signal transduction pathway to understand and predict the formation of fear memory under stressful conditions. The research scholar will spend full time on this project to build new models and expected to contribute significantly to prepare the results for publication and presentation, and to contribute to grant proposals. </p>

<p>Required Qualifications: Masters in physics/chemistry/mathematics (or) MTech in bioengineering, chemical (or) Masters in any traditional field of science with outstanding performance throughout the program. Candidate should have cleared GATE/UGC-CSIR examinations. Applicant should have done basic mathematics courses like calculus, differential equations, numerical analysis etc in their degree program and have obtained good grades in those courses. Knowledge of MATLAB and C or at least one traditional programming language is absolutely necessary. Strong inclination to understand biological concepts is a must for this research work as this project is about modeling biological systems.     </p>

<p>Salary: A fixed salary of Rs 18000 PM including HRA will be paid. </p>

<p>Last date for application: This advertisement is open until suitable candidate is found for the project. </p>

<p>Preferred Qualifications:  - Expertise in dynamical systems theory, bifurcation theory, numerical simulations, parameter estimation. </p>

<p>Independence and high motivation for carrying out interdisciplinary research. - Excellent communication skills and ability to work independently. - Good working habits. </p>

<p>Interested candidates should submit both curriculum vitae and statement of interest in PDF format to sriramk@iiitd.ac.in and should clearly mention in the subject "Application for SRF".</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>

</channel>
</rss>