<![CDATA[BOL: Related items]]> https://bioinformaticsonline.com/related/37627?offset=50 https://bioinformaticsonline.com/bookmarks/view/26539/scikit-learn Mon, 29 Feb 2016 17:39:24 -0600 https://bioinformaticsonline.com/bookmarks/view/26539/scikit-learn <![CDATA[scikit-learn]]> Machine Learning in Python

Simple and efficient tools for data mining and data analysis
Accessible to everybody, and reusable in various contexts
Built on NumPy, SciPy, and matplotlib
Open source, commercially usable - BSD license

More at http://scikit-learn.org/stable/index.html

 

Address of the bookmark: http://scikit-learn.org/stable/auto_examples/index.html

]]> Jitendra Prajapati https://bioinformaticsonline.com/pages/view/35805/python-learning-resources-for-bioinformatics-and-computational-biologist Fri, 02 Mar 2018 06:54:15 -0600 https://bioinformaticsonline.com/pages/view/35805/python-learning-resources-for-bioinformatics-and-computational-biologist <![CDATA[Python learning resources for bioinformatics and computational biologist !]]> Python is a general-purpose language, which means it can be used to build just about anything, which will be made easy with the right tools/libraries.

Professionally, Python is great for backend web development, data analysis, artificial intelligence, and scientific computing. Many developers have also used Python to build productivity tools, games, and desktop apps, so there are plenty of resources to help you learn how to do those as well.

For pros and cons visit http://www.bestprogramminglanguagefor.me/why-learn-python and http://bioinformaticsonline.com/discussion/view/459/python-vs-perl

More resources at https://github.com/CodementorIO/Python-Learning-Resources

Following are the list of useful python programming resources:

]]> Jit https://bioinformaticsonline.com/bookmarks/view/40298/environment-for-tree-exploration-ete-is-a-python-programming-toolkit-that-assists-in-the-recontruction-manipulation-analysis-and-visualization-of-phylogenetic-trees Wed, 27 Nov 2019 05:32:33 -0600 https://bioinformaticsonline.com/bookmarks/view/40298/environment-for-tree-exploration-ete-is-a-python-programming-toolkit-that-assists-in-the-recontruction-manipulation-analysis-and-visualization-of-phylogenetic-trees <![CDATA[Environment for Tree Exploration (ETE) is a Python programming toolkit that assists in the recontruction, manipulation, analysis and visualization of phylogenetic trees]]> The Environment for Tree Exploration (ETE) is a Python programming toolkit that assists in the recontruction, manipulation, analysis and visualization of phylogenetic trees (although clustering trees or any other tree-like data structure are also supported).

Other tools

https://github.com/shenwei356/taxonkit

 

Address of the bookmark: https://pypi.org/project/ete3/3.1.1/

]]> Rahul Nayak https://bioinformaticsonline.com/bookmarks/view/42923/flanker Sat, 27 Feb 2021 22:04:53 -0600 https://bioinformaticsonline.com/bookmarks/view/42923/flanker <![CDATA[Flanker]]> Flanker, a Python package which performs alignment-free clustering of gene flanking sequences in a consistent format, allowing investigation of mobile genetic elements (MGEs) without prior knowledge of their structure. Flanker can be flexibly parameterised to finetune outputs by characterising upstream and downstream regions separately and investigating variable lengths of flanking sequence.

image

Address of the bookmark: https://github.com/wtmatlock/flanker

]]> Rahul Nayak https://bioinformaticsonline.com/bookmarks/view/35800/scikit-bio%E2%84%A2-is-an-open-source-bsd-licensed-python-package-providing-data-structures-algorithms-and-educational-resources-for-bioinformatics Fri, 02 Mar 2018 04:29:47 -0600 https://bioinformaticsonline.com/bookmarks/view/35800/scikit-bio%E2%84%A2-is-an-open-source-bsd-licensed-python-package-providing-data-structures-algorithms-and-educational-resources-for-bioinformatics <![CDATA[scikit-bio™ is an open-source, BSD-licensed, python package providing data structures, algorithms, and educational resources for bioinformatics.]]> scikit-bio is currently in beta. We are very actively developing it, and backward-incompatible interface changes can and will arise. To avoid these types of changes being a surprise to our users, our public APIs are decorated to make it clear to users when an API can be relied upon (stable) and when it may be subject to change (experimental). See the API stability docs for more details, including what we mean by stable and experimental in this context.

Address of the bookmark: http://scikit-bio.org/

]]> Jit https://bioinformaticsonline.com/bookmarks/view/41487/tinycov-standalone-command-line-utility-written-in-python-to-plot-coverage-from-a-bam-file Mon, 23 Mar 2020 06:22:08 -0500 https://bioinformaticsonline.com/bookmarks/view/41487/tinycov-standalone-command-line-utility-written-in-python-to-plot-coverage-from-a-bam-file <![CDATA[tinycov: standalone command line utility written in python to plot coverage from a BAM file]]> Tinycov is a small standalone command line utility written in python to plot the coverage of a BAM file quickly. This software was inspired by Matt Edwards' genome coverage plotter.

To install the stable version: pip3 install --user tinycov

To install the development version:

git clone https://github.com/cmdoret/tinycov.git
cd tinycov
pip install .

Address of the bookmark: https://github.com/cmdoret/tinycov

]]> Jit https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting Fri, 15 Jun 2018 10:39:54 -0500 https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting <![CDATA[LINKS scaffolder bloomfilter setting !]]> ➜ bin git:(master) ✗ ls -l
total 68
drwxrwxr-x 3 urbe urbe 4096 Jun 15 12:15 lib
-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS
➜ bin git:(master) ✗ pwd
/home/urbe/Tools/LINKS_1.8.6/bin

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

]]> Jit https://bioinformaticsonline.com/news/view/8848/upgrade-r-303 Mon, 10 Mar 2014 11:23:51 -0500 https://bioinformaticsonline.com/news/view/8848/upgrade-r-303 <![CDATA[Upgrade R 3.0.3]]> R is a free software programming language and software environment for statistical computing and graphics. The R language is widely used among statisticians and data miners for developing statistical software and data analysis. Polls and surveys of data miners are showing R's popularity has increased substantially in recent years. Recently the new version of R codename “Warm Puppy" have been released.

You can download the latest version from here http://cran.rstudio.com/ . Or, if you are using Windows, you can upgrade to the latest version using the installr package http://cran.r-project.org/web/packages/installr/ . Simply run the following code:

# installing/loading the package:
if(!require(installr)) {
install.packages("installr"); require(installr)} #load / install+load installr
 
updateR()

I try to keep the installr package updated and useful. If you have any suggestions or remarks on the package, you’re invited to leave a comment below.

If you use the global library system http://www.r-statistics.com/2010/04/changing-your-r-upgrading-strategy-and-the-r-code-to-do-it-on-windows/ , you can run the following in the new version of R:

source("http://www.r-statistics.com/wp-content/uploads/2010/04/upgrading-R-on-windows.r.txt")
New.R.RunMe()

Reference:

http://www.r-statistics.com/2014/03/r-3-0-3-is-released/

]]> Rahul Nayak https://bioinformaticsonline.com/pages/view/9028/linux-for-bioinformatician Thu, 13 Mar 2014 16:59:26 -0500 https://bioinformaticsonline.com/pages/view/9028/linux-for-bioinformatician <![CDATA[Linux for bioinformatician !!!]]> Linux, free operating system for computers, provides several powerful admin tools and utilities which will help you to manage your systems effectively and handle huge amount of genomic/biological data with an ease. The field of bioinformatics relies heavily on Linux-based computers and software. Although most bioinformatics programs can be compiled to run. If you don’t know what these no so user-friendly tools are and how to use them, you could be spending lot of time trying to perform even the basic admin tasks. The focus of this linux series is to help you understand system admin as well as basic tools, which will help you to become an effective bioinformatician and computational biologist.

For knowledge about Linux and their importance amongst bioinformatician plesae read this article "An introduction to Linux for bioinformatics" by Paul Stothard.

Linux cheat sheet at http://bioinformaticsonline.com/file/view/87/linux-cheat-sheet

Please browse for futher useful linux pages on right hand side ...

]]> Rahul Nayak https://bioinformaticsonline.com/pages/view/11313/linux-sort-commands-for-bioinformatics Sat, 31 May 2014 15:41:16 -0500 https://bioinformaticsonline.com/pages/view/11313/linux-sort-commands-for-bioinformatics <![CDATA[Linux Sort Commands for Bioinformatics]]> Almost all the scripting languages such as Perl, Python etc have built-in sort, but unfortunately none of them are as flexible as sort command. But one when it come to space efficiency GNU sort stands at the top. It can sort a 20Gb file with less than 2Gb memory. It is not trivial to implement so powerful a sort by yourself.

sort a space-delimited file based on its first column, then the second if the first is the same, and so on:
sort input.txt

sort a huge file (GNU sort ONLY):
sort -S 1500M -t $HOME/tmp input.txt > sorted.txt

sort starting from the third column, skipping the first two columns:
sort +2 input.txt

sort the second column as numbers, descending order; if identical, sort the 3rd as strings, ascending order:
sort -k2,2nr -k3,3 input.txt

sort starting from the 4th character at column 2, as numbers:
sort -k2.4n input.txt

More Linxu sort command information

If you have any sort commands you'd like to share, please add them to our comments section below. For more help, you can also type:

man sort

or

sort --help

on your Unix/Linux system.

]]> Rahul Nayak