BOL: Related items

RaGOO: Fast Reference-Guided Scaffolding of Genome Assembly Contigs

BioJoker — Wed, 17 Apr 2019 19:45:22 -0500

Alonge M, Soyk S, Ramakrishnan S, Wang X, Goodwin S, Sedlazeck FJ, Lippman ZB, Schatz MC: Fast and accurate reference-guided scaffolding of draft genomes. bioRxiv 2019.

RaGOO is a tool for coalescing genome assembly contigs into pseudochromosomes via minimap2 alignments to a closely related reference genome. The focus of this tool is on practicality and therefore has the following features:

Good performance. On a MacBook Pro using Arabidopsis data, pseudochromosome construction takes less than a minute and the whole pipeline with SV calling takes ~2 minutes.
Intact ordering and orienting of contigs.
Chimeric contig correction
GFF lift-over
Structural variant calling with and integrated version of Assemblytics
Confidence scores associated with the grouping, localization, and orientation for each contig.

Address of the bookmark: https://github.com/malonge/RaGOO

MUMmer4: A fast and versatile genome alignment system

Jit — Sat, 03 Feb 2018 04:59:17 -0600

MUMmer4, a substantially improved version of MUMmer that addresses genome size constraints by changing the 32-bit suffix tree data structure at the core of MUMmer to a 48-bit suffix array, and that offers improved speed through parallel processing of input query sequences. With a theoretical limit on the input size of 141Tbp, MUMmer4 can now work with input sequences of any biologically realistic length. We show that as a result of these enhancements, the nucmer program in MUMmer4 is easily able to handle alignments of large genomes;

Address of the bookmark: https://mummer4.github.io/

RefKA: A fast and efficient long-read genome assembly approach for large and complex genomes

Rahul Nayak — Fri, 01 May 2020 03:00:40 -0500

RefKA, a reference-based approach for long read genome assembly. This approach relies on breaking up a closely related reference genome into bins, aligning k-mers unique to each bin with PacBio reads, and then assembling each bin in parallel followed by a final bin-stitching step.

Address of the bookmark: https://github.com/AppliedBioinformatics/RefKA

LINKS scaffolder bloomfilter setting !

Jit — Fri, 15 Jun 2018 10:39:54 -0500

➜ bin git:(master) ✗ ls -l
total 68
drwxrwxr-x 3 urbe urbe 4096 Jun 15 12:15 lib
-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS
➜ bin git:(master) ✗ pwd
/home/urbe/Tools/LINKS_1.8.6/bin

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr

Genome U-Plot: a whole genome visualization

Rahul Nayak — Fri, 13 Jul 2018 19:50:41 -0500

Genome U-Plot for producing clear and intuitive graphs that allows researchers to generate novel insights and hypotheses by visualizing SVs such as deletions, amplifications, and chromoanagenesis events. The main features of the Genome U-Plot are its layered layout, its high spatial resolution and its improved aesthetic qualities.

https://github.com/gaitat/GenomeUPlot

Address of the bookmark: https://github.com/gaitat/GenomeUPlot

Long read assembly workshop !

Rahul Nayak — Thu, 04 Oct 2018 17:23:18 -0500

This is a tutorial for a workshop on long-read (PacBio) genome assembly.

It demonstrates how to use long PacBio sequencing reads to assemble a bacterial genome, and includes additional steps for circularising, trimming, finding plasmids, and correcting the assembly with short-read Illumina data.

Please comment if you know any other long read addembly tutorial.

Address of the bookmark: http://sepsis-omics.github.io/tutorials/modules/cmdline_assembly_v2/

KAD: Assessing genome assemblies using K-mer copies in assemblies and K-mer abundance in Illumina reads

Jit — Fri, 19 Jun 2020 07:34:12 -0500

KAD is designed for evaluating the accuracy of nucleotide base quality of genome assemblies. Briefly, abundance of k-mers are quantified for both sequencing reads and assembly sequences. Comparison of the two values results in a single value per k-mer, K-mer Abundance Difference (KAD), which indicates how well the assembly matches read data for each k-mer.

where, c is the count of a k-mer from reads, m is the mode of counts of read k-mers, and n is the copy of the k-mer in the assembly.

Address of the bookmark: https://github.com/liu3zhenlab/KAD

Smudgeplot: Inference of ploidy and heterozygosity structure using whole genome sequencing data

Neel — Fri, 25 Feb 2022 04:42:09 -0600

This tool extracts heterozygous kmer pairs from kmer count databases and performs gymnastics with them. We are able to disentangle genome structure by comparing the sum of kmer pair coverages (CovA + CovB) to their relative coverage (CovB / (CovA + CovB)). Such an approach also allows us to analyze obscure genomes with duplications, various ploidy levels, etc.

Smudgeplots are computed from raw or even better from trimmed reads and show the haplotype structure using heterozygous kmer pairs. For example:

Address of the bookmark: https://github.com/KamilSJaron/smudgeplot

How to sequence the human genome - Mark J. Kiel

Fri, 30 May 2014 13:24:11 -0500

View full lesson: http://ed.ted.com/lessons/how-to-sequence-the-human-genome-mark-j-kiel Your genome, every human's genome, consists of a unique DNA sequence of A's, T's, C's and G's that tell your cells how to operate. Thanks to technological advances, scientists are now able to know the sequence of letters that makes up an individual genome relatively quickly and inexpensively. Mark J. Kiel takes an in-depth look at the science behind the sequence. Lesson by Mark J. Kiel, animation by Marc Christoforidis.

BIMA V3: an aligner customized for mate pair library sequencing

Abhimanyu Singh — Wed, 14 Dec 2016 15:20:00 -0600

Summary: Mate pair library sequencing is an effective and economical method for detecting genomic structural variants and chromosomal abnormalities. Unfortunately, the mapping and alignment of mate pair read pairs to a reference genome is a challenging and
time consuming process for most NGS alignment programs. Large insert sizes, introduction of library preparation protocol artifacts (biotin junction reads, paired-end read contamination, chimeras, etc.), and presence of structural variant breakpoints within reads increases mapping and alignment complexity. We describe an algorithm that is up to 20 times faster and 25% more accurate than popular NGS alignment programs when processing mate pair sequencing.
Availability: http://bioinformaticstools.mayo.edu/research/bima/
Contact: vasmatzis.george@mayo.edu

Address of the bookmark: http://bioinformatics.oxfordjournals.org/content/early/2014/02/12/bioinformatics.btu078.full.pdf