<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/37650?offset=80</link>
	<atom:link href="https://bioinformaticsonline.com/related/37650?offset=80" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42826/ktrim-an-extra-fast-and-accurate-adapter-and-quality-trimmer-for-sequencing-data</guid>
	<pubDate>Thu, 11 Feb 2021 21:39:05 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42826/ktrim-an-extra-fast-and-accurate-adapter-and-quality-trimmer-for-sequencing-data</link>
	<title><![CDATA[Ktrim: an extra-fast and accurate adapter- and quality-trimmer for sequencing data]]></title>
	<description><![CDATA[<p>Ktrim&nbsp;is written in&nbsp;<code style="font-size: 13.6px; padding: 0.2em 0.4em; margin: 0px; background-color: var(--color-markdown-code-bg);">C++</code>&nbsp;for GNU Linux/Unix platforms. After uncompressing the source package, you can find an executable file&nbsp;<code style="font-size: 13.6px; padding: 0.2em 0.4em; margin: 0px; background-color: var(--color-markdown-code-bg);">ktrim</code>&nbsp;under&nbsp;<code style="font-size: 13.6px; padding: 0.2em 0.4em; margin: 0px; background-color: var(--color-markdown-code-bg);">bin/</code>&nbsp;directory compiled using&nbsp;<code style="font-size: 13.6px; padding: 0.2em 0.4em; margin: 0px; background-color: var(--color-markdown-code-bg);">g++ v4.8.5</code>&nbsp;and linked with&nbsp;<code style="font-size: 13.6px; padding: 0.2em 0.4em; margin: 0px; background-color: var(--color-markdown-code-bg);">libz v1.2.7</code>&nbsp;for Linux x86_64 system. If you could not run it (which is usually caused by low version of&nbsp;<code style="font-size: 13.6px; padding: 0.2em 0.4em; margin: 0px; background-color: var(--color-markdown-code-bg);">libc++</code>&nbsp;or&nbsp;<code style="font-size: 13.6px; padding: 0.2em 0.4em; margin: 0px; background-color: var(--color-markdown-code-bg);">libz</code>&nbsp;library) or you want to build a version optimized for your system, you can re-compile the programs:</p>
<p>user@linux$ make clean &amp;&amp; make</p><p>Address of the bookmark: <a href="https://github.com/hellosunking/Ktrim" rel="nofollow">https://github.com/hellosunking/Ktrim</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44896/jaeger-an-accurate-and-fast-deep-learning-tool-to-detect-bacteriophage-sequences</guid>
	<pubDate>Sun, 31 Aug 2025 06:30:16 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44896/jaeger-an-accurate-and-fast-deep-learning-tool-to-detect-bacteriophage-sequences</link>
	<title><![CDATA[Jaeger : an accurate and fast deep-learning tool to detect bacteriophage sequences]]></title>
	<description><![CDATA[<p><span>Jaeger is a tool that utilizes homology-free machine learning to identify phage genome sequences that are hidden within metagenomes. It is capable of detecting both phages and prophages within metagenomic assemblies.</span></p><p>Address of the bookmark: <a href="https://github.com/MGXlab/Jaeger" rel="nofollow">https://github.com/MGXlab/Jaeger</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41452/apollo-a-sequencing-technology-independent-scalable-and-accurate-assembly-polishing-algorithm</guid>
	<pubDate>Mon, 16 Mar 2020 10:09:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41452/apollo-a-sequencing-technology-independent-scalable-and-accurate-assembly-polishing-algorithm</link>
	<title><![CDATA[Apollo: A Sequencing-Technology-Independent, Scalable, and Accurate Assembly Polishing Algorithm]]></title>
	<description><![CDATA[<p><span>Apollo is an assembly polishing algorithm that attempts to correct the errors in an assembly. It can take multiple set of reads in a single run and polish the assemblies of genomes of any size. Described by Firtina et al. (preliminary version at&nbsp;</span><a href="https://arxiv.org/pdf/1902.04341.pdf">https://arxiv.org/pdf/1902.04341.pdf</a></p>
<p>More at&nbsp;<a href="https://academic.oup.com/bioinformatics/advance-article/doi/10.1093/bioinformatics/btaa179/5804978?rss=1">https://academic.oup.com/bioinformatics/advance-article/doi/10.1093/bioinformatics/btaa179/5804978?rss=1</a></p><p>Address of the bookmark: <a href="https://github.com/CMU-SAFARI/Apollo" rel="nofollow">https://github.com/CMU-SAFARI/Apollo</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39269/ragoo-fast-reference-guided-scaffolding-of-genome-assembly-contigs</guid>
	<pubDate>Wed, 17 Apr 2019 19:45:22 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39269/ragoo-fast-reference-guided-scaffolding-of-genome-assembly-contigs</link>
	<title><![CDATA[RaGOO: Fast Reference-Guided Scaffolding of Genome Assembly Contigs]]></title>
	<description><![CDATA[<p>Alonge M, Soyk S, Ramakrishnan S, Wang X, Goodwin S, Sedlazeck FJ, Lippman ZB, Schatz MC:&nbsp;<a href="https://www.biorxiv.org/content/early/2019/01/13/519637">Fast and accurate reference-guided scaffolding of draft genomes</a>.&nbsp;<em>bioRxiv</em>&nbsp;2019.</p>
<p>RaGOO is a tool for coalescing genome assembly contigs into pseudochromosomes via minimap2 alignments to a closely related reference genome. The focus of this tool is on practicality and therefore has the following features:</p>
<ol>
<li>Good performance. On a MacBook Pro using Arabidopsis data, pseudochromosome construction takes less than a minute and the whole pipeline with SV calling takes ~2 minutes.</li>
<li>Intact ordering and orienting of contigs.</li>
<li><a href="https://github.com/malonge/RaGOO/wiki/Breaking-Chimeric-Contigs">Chimeric contig correction</a></li>
<li><a href="https://github.com/malonge/RaGOO/wiki/GFF-File-Lift-Over">GFF lift-over</a></li>
<li><a href="https://github.com/malonge/RaGOO/wiki/Calling-Structural-Variants">Structural variant calling with and integrated version of Assemblytics</a></li>
<li>Confidence scores associated with the grouping, localization, and orientation for each contig.</li>
</ol><p>Address of the bookmark: <a href="https://github.com/malonge/RaGOO" rel="nofollow">https://github.com/malonge/RaGOO</a></p>]]></description>
	<dc:creator>BioJoker</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35432/mummer4-a-fast-and-versatile-genome-alignment-system</guid>
	<pubDate>Sat, 03 Feb 2018 04:59:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35432/mummer4-a-fast-and-versatile-genome-alignment-system</link>
	<title><![CDATA[MUMmer4: A fast and versatile genome alignment system]]></title>
	<description><![CDATA[<p><span>MUMmer4, a substantially improved version of MUMmer that addresses genome size constraints by changing the 32-bit suffix tree data structure at the core of MUMmer to a 48-bit suffix array, and that offers improved speed through parallel processing of input query sequences. With a theoretical limit on the input size of 141Tbp, MUMmer4 can now work with input sequences of any biologically realistic length. We show that as a result of these enhancements, the&nbsp;</span><span>nucmer</span><span>&nbsp;program in MUMmer4 is easily able to handle alignments of large genomes;&nbsp;</span></p><p>Address of the bookmark: <a href="https://mummer4.github.io/" rel="nofollow">https://mummer4.github.io/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41592/refka-a-fast-and-efficient-long-read-genome-assembly-approach-for-large-and-complex-genomes</guid>
	<pubDate>Fri, 01 May 2020 03:00:40 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41592/refka-a-fast-and-efficient-long-read-genome-assembly-approach-for-large-and-complex-genomes</link>
	<title><![CDATA[RefKA: A fast and efficient long-read genome assembly approach for large and complex genomes]]></title>
	<description><![CDATA[<p><span>RefKA, a reference-based approach for long read genome assembly. This approach relies on breaking up a closely related reference genome into bins, aligning k-mers unique to each bin with PacBio reads, and then assembling each bin in parallel followed by a final bin-stitching step.</span></p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://github.com/AppliedBioinformatics/RefKA" rel="nofollow">https://github.com/AppliedBioinformatics/RefKA</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37306/genome-u-plot-a-whole-genome-visualization</guid>
	<pubDate>Fri, 13 Jul 2018 19:50:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37306/genome-u-plot-a-whole-genome-visualization</link>
	<title><![CDATA[Genome U-Plot: a whole genome visualization]]></title>
	<description><![CDATA[<p><span>Genome U-Plot for producing clear and intuitive graphs that allows researchers to generate novel insights and hypotheses by visualizing SVs such as deletions, amplifications, and chromoanagenesis events. The main features of the Genome U-Plot are its layered layout, its high spatial resolution and its improved aesthetic qualities.&nbsp;</span></p>
<p><span>https://github.com/gaitat/GenomeUPlot</span></p><p>Address of the bookmark: <a href="https://github.com/gaitat/GenomeUPlot" rel="nofollow">https://github.com/gaitat/GenomeUPlot</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37840/long-read-assembly-workshop</guid>
	<pubDate>Thu, 04 Oct 2018 17:23:18 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37840/long-read-assembly-workshop</link>
	<title><![CDATA[Long read assembly workshop !]]></title>
	<description><![CDATA[<p>This is a tutorial for a workshop on long-read (PacBio) genome assembly.</p>
<p>It demonstrates how to use long PacBio sequencing reads to assemble a bacterial genome, and includes additional steps for circularising, trimming, finding plasmids, and correcting the assembly with short-read Illumina data.</p>
<p>&nbsp;Please comment if you know any other long read addembly tutorial.</p><p>Address of the bookmark: <a href="http://sepsis-omics.github.io/tutorials/modules/cmdline_assembly_v2/" rel="nofollow">http://sepsis-omics.github.io/tutorials/modules/cmdline_assembly_v2/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40465/airlift-a-methodology-and-tool-for-comprehensively-moving-mappings-and-annotations-from-one-genome-to-another-similar-genome</guid>
	<pubDate>Mon, 23 Dec 2019 10:20:13 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40465/airlift-a-methodology-and-tool-for-comprehensively-moving-mappings-and-annotations-from-one-genome-to-another-similar-genome</link>
	<title><![CDATA[AirLift, a methodology and tool for comprehensively moving mappings and annotations from one genome to another similar genome]]></title>
	<description><![CDATA[<p>We propose AirLift, a methodology and tool for comprehensively moving mappings and annotations from one genome to another similar genome while maintaining the accuracy of a full mapper.</p><p>Address of the bookmark: <a href="https://github.com/CMU-SAFARI/AirLift" rel="nofollow">https://github.com/CMU-SAFARI/AirLift</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>