<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/37785?offset=330</link>
	<atom:link href="https://bioinformaticsonline.com/related/37785?offset=330" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</guid>
	<pubDate>Fri, 26 Oct 2018 08:25:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38023/mitos-improved-de-novo-metazoan-mitochondrial-genome-annotation</link>
	<title><![CDATA[MITOS: improved de novo metazoan mitochondrial genome annotation]]></title>
	<description><![CDATA[<p><span>Allows automatic annotation of metazoan mitochondrial genomes. MITOS is a pipeline designed to compute a consistent de novo annotation of the mitogenomic sequences. The software allows for a systematic error screening, the standardisation of gene name and gene boundary designation, anticodon labelling of tRNAs, and provides the means for the assessment of the validity of a gene assignment.</span></p><p>Address of the bookmark: <a href="http://mitos.bioinf.uni-leipzig.de/index.py" rel="nofollow">http://mitos.bioinf.uni-leipzig.de/index.py</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</guid>
	<pubDate>Fri, 09 Nov 2018 13:50:04 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38176/asciigenome-genome-browser-based-on-command-line-interface-and-designed-for-running-from-console-terminals</link>
	<title><![CDATA[ASCIIGenome: genome browser based on command line interface and designed for running from console terminals.]]></title>
	<description><![CDATA[<p><code>ASCIIGenome</code>&nbsp;is a genome browser based on command line interface and designed for running from console terminals.</p>
<p>Since&nbsp;<code>ASCIIGenome</code>&nbsp;does not require a graphical interface it is particularly useful for quickly visualizing genomic data on remote servers while offering flexibility similar to popular GUI viewers like&nbsp;<a href="https://www.broadinstitute.org/igv/">IGV</a>.</p>
<p><span>Documentation</span>&nbsp;is at&nbsp;<a href="http://asciigenome.readthedocs.io/en/latest/">readthedocs/asciigenome</a>.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://github.com/dariober/ASCIIGenome" rel="nofollow">https://github.com/dariober/ASCIIGenome</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38443/genoplotr-plot-gene-and-genome-maps-project</guid>
	<pubDate>Wed, 12 Dec 2018 08:33:41 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38443/genoplotr-plot-gene-and-genome-maps-project</link>
	<title><![CDATA[genoPlotR - plot gene and genome maps project!]]></title>
	<description><![CDATA[<p>genoPlotR is a R package to produce reproducible, publication-grade graphics of gene and genome maps. It allows the user to read from usual format such as protein table files and blast results, as well as home-made tabular files.</p>
<h3>Features</h3>
<ul>
<li>Linear representation of several segments of DNA</li>
<li>Comparisons represented by areas between the segments (like Artemis, for example)</li>
<li>Reads from common formats: Genbank, EMBL, blast, Mauve, and from user-generated tab files</li>
<li>Plot several subsegments of the same segment on the same line, separated by a //</li>
<li>Automatic or manual placement of the segments on the plot</li>
<li>Add annotations to all the lines</li>
<li>Create smart, automatic annotations for genomes, based on gene names</li>
<li>Add a user-generated tree</li>
<li>Add a global scale or a scale to each line</li>
<li>Use user-defined graphical functions to represent genes</li>
<li></li>
</ul><p>Address of the bookmark: <a href="http://genoplotr.r-forge.r-project.org/" rel="nofollow">http://genoplotr.r-forge.r-project.org/</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38670/ltr-finder-an-efficient-program-for-finding-full-length-ltr-retrotranspsons-in-genome-sequences</guid>
	<pubDate>Sun, 13 Jan 2019 07:05:53 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38670/ltr-finder-an-efficient-program-for-finding-full-length-ltr-retrotranspsons-in-genome-sequences</link>
	<title><![CDATA[LTR_Finder: an efficient program for finding full-length LTR retrotranspsons in genome sequences.]]></title>
	<description><![CDATA[<p>LTR_Finder is an efficient program for finding full-length LTR retrotranspsons in genome sequences.</p>
<p>The Program first constructs all exact match pairs by a suffix-array based algorithm and extends them to long highly similar pairs. Then Smith-Waterman algorithm is used to adjust the ends of LTR pair candidates to get alignment boundaries. These boundaries are subject to re-adjustment using supporting information of TG..CA box and TSRs and reliable LTRs are selected. Next, LTR_FINDER tries to identify PBS, PPT and RT inside LTR pairs by build-in aligning and counting modules. RT identification includes a dynamic programming to process frame shift. For other protein domains, LTR_FINDER calls ps_scan (from PROSITE,&nbsp;<a href="http://www.expasy.org/prosite/">http://www.expasy.org/prosite/</a>) to locate cores of important enzymes if they occur.</p><p>Address of the bookmark: <a href="https://github.com/xzhub/LTR_Finder" rel="nofollow">https://github.com/xzhub/LTR_Finder</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39450/apollo-first-instantaneous-collaborative-genomic-annotation-editor-available-on-the-web</guid>
	<pubDate>Fri, 31 May 2019 19:55:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39450/apollo-first-instantaneous-collaborative-genomic-annotation-editor-available-on-the-web</link>
	<title><![CDATA[Apollo: First instantaneous, collaborative genomic annotation editor available on the Web]]></title>
	<description><![CDATA[<ul>
<li>Apollo is a plug-in for the&nbsp;<a href="http://jbrowse.org/">JBrowse</a>&nbsp;Genome Viewer.</li>
<li>In addition to genes and pseudogenes, users can annotate ncRNAs (snRNA, snoRNA, tRNA, rRNA), miRNAs, repeat regions, and transposable elements; each annotation type has its own configuration of the &lsquo;Information Editor&rsquo;.</li>
<li>History tracking with undo/redo functions is available.</li>
<li>Users are able to directly set an annotation to a specific state, choosing from the &lsquo;History&rsquo; display.</li>
<li>Adding and updating PubMed IDs will prompt users with a publication title to confirm their submission.</li>
<li>Gene Ontology (GO) terms are supported and GO ID auto-completion has been incorporated.</li>
<li>Users may access a &lsquo;Recent Changes&rsquo; page.</li>
<li>Help page with Apollo specific content is available.</li>
</ul><p>Address of the bookmark: <a href="http://genomearchitect.github.io/" rel="nofollow">http://genomearchitect.github.io/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40302/simug-a-general-purpose-genome-simulator</guid>
	<pubDate>Thu, 28 Nov 2019 04:33:18 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40302/simug-a-general-purpose-genome-simulator</link>
	<title><![CDATA[simuG: a general-purpose genome simulator]]></title>
	<description><![CDATA[<p><span>Simulated genomes with pre-defined and random genomic variants can be very useful for benchmarking genomic and bioinformatics analyses. Here we introduce simuG, a lightweight tool for simulating the full-spectrum of genomic variants (single nucleotide polymorphisms, Insertions/Deletions, copy number variants, inversions and translocations) for any organisms (including human). The simplicity and versatility of simuG make it a unique general-purpose genome simulator for a wide-range of simulation-based applications.</span></p><p>Address of the bookmark: <a href="https://github.com/yjx1217/simuG" rel="nofollow">https://github.com/yjx1217/simuG</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40715/mutatrix-a-population-genome-simulator-which-generates-simulated-genomes</guid>
	<pubDate>Tue, 28 Jan 2020 04:06:58 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40715/mutatrix-a-population-genome-simulator-which-generates-simulated-genomes</link>
	<title><![CDATA[mutatrix: a population genome simulator which generates simulated genomes.]]></title>
	<description><![CDATA[<p><span>genome simulation across a population with zeta-distributed allele frequency, snps, insertions, deletions, and multi-nucleotide polymorphisms</span></p>
<p><span>More at&nbsp;<a href="https://github.com/ekg/mutatrix">https://github.com/ekg/mutatrix</a></span></p>
<pre>./mutatrix -S sample -P test/ -p 2 -n 10 reference.fasta</pre><p>Address of the bookmark: <a href="https://github.com/ekg/mutatrix" rel="nofollow">https://github.com/ekg/mutatrix</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41275/shinychromosomea-gui-for-the-interactive-creation-of-non-circular-whole-genome-diagrams</guid>
	<pubDate>Sat, 29 Feb 2020 00:39:50 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41275/shinychromosomea-gui-for-the-interactive-creation-of-non-circular-whole-genome-diagrams</link>
	<title><![CDATA[shinyChromosome:a GUI for the interactive creation of non-circular whole genome diagrams]]></title>
	<description><![CDATA[<p><code>shinyChromosome</code> is a graphical user interface for interactive creation of non-circular whole genome diagrams developed using the R <strong>Shiny</strong> package.</p>
<p>To create single-genome plot by aligning genome data along all chromosomes of a single genome, go to the <code>Single-genome plot</code> menu.</p>
<p>To cretae two-genome plot for comparison of data across two genomes, go to the <code>Two-genome plot</code> menu.</p>
<p>For the detail format of input data, check the <code>Input data format</code> submenu of the <code>Help</code> menu.</p>
<p>shinyChromosome is deployed at <a href="http://150.109.59.144:3838/shinyChromosome/" target="_blank">http://150.109.59.144:3838/shinyChromosome/</a>, <a href="http://shinyChromosome.ncpgr.cn" target="_blank">http://shinyChromosome.ncpgr.cn</a>, and <a href="https://yimingyu.shinyapps.io/shinyChromosome" target="_blank">https://yimingyu.shinyapps.io/shinyChromosome</a> for online use. The source code and manual of shinyChromosome are freely available at <a href="https://github.com/venyao/shinyChromosome" target="_blank">https://github.com/venyao/shinyChromosome</a>.</p>
<p>https://yimingyu.shinyapps.io/shinychromosome/</p>
<p>https://www.sciencedirect.com/science/article/pii/S1672022919301883</p><p>Address of the bookmark: <a href="https://yimingyu.shinyapps.io/shinychromosome/" rel="nofollow">https://yimingyu.shinyapps.io/shinychromosome/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>