<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/37959?offset=140</link>
	<atom:link href="https://bioinformaticsonline.com/related/37959?offset=140" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/27973/wgsim</guid>
	<pubDate>Thu, 23 Jun 2016 07:26:49 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/27973/wgsim</link>
	<title><![CDATA[WgSim]]></title>
	<description><![CDATA[<p>Reads simulator</p>
<p>Wgsim is a small tool for simulating sequence reads from a reference genome. It is able to simulate diploid genomes with SNPs and insertion/deletion (INDEL) polymorphisms, and simulate reads with uniform substitution sequencing errors. It does not generate INDEL sequencing errors, but this can be partly compensated by simulating INDEL polymorphisms.<br><br>Wgsim outputs the simulated polymorphisms, and writes the true read coordinates as well as the number of polymorphisms and sequencing errors in read names. One can evaluate the accuracy of a mapper or a SNP caller with wgsim_eval.pl that comes with the package.<br><br></p><p>Address of the bookmark: <a href="https://github.com/lh3/wgsim" rel="nofollow">https://github.com/lh3/wgsim</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/30144/bima-v3-an-aligner-customized-for-mate-pair-library-sequencing</guid>
	<pubDate>Wed, 14 Dec 2016 15:20:00 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/30144/bima-v3-an-aligner-customized-for-mate-pair-library-sequencing</link>
	<title><![CDATA[BIMA V3: an aligner customized for mate pair library sequencing]]></title>
	<description><![CDATA[<p>Summary: Mate pair library sequencing is an effective and economical method for detecting genomic structural variants and chromosomal abnormalities. Unfortunately, the mapping and alignment of mate pair read pairs to a reference genome is a challenging and <br>time consuming process for most NGS alignment programs. Large insert sizes, introduction of library preparation protocol artifacts (biotin junction reads, paired-end read contamination, chimeras, etc.), and presence of structural variant breakpoints within reads increases mapping and alignment complexity. We describe an algorithm that is up to 20 times faster and 25% more accurate than popular NGS alignment programs when processing mate pair sequencing. <br>Availability: http://bioinformaticstools.mayo.edu/research/bima/ <br>Contact: vasmatzis.george@mayo.edu</p><p>Address of the bookmark: <a href="http://bioinformatics.oxfordjournals.org/content/early/2014/02/12/bioinformatics.btu078.full.pdf" rel="nofollow">http://bioinformatics.oxfordjournals.org/content/early/2014/02/12/bioinformatics.btu078.full.pdf</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/31156/splitbam-splits-a-bam-by-chromosomes</guid>
	<pubDate>Tue, 28 Feb 2017 09:01:28 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/31156/splitbam-splits-a-bam-by-chromosomes</link>
	<title><![CDATA[splitbam: splits a BAM by chromosomes]]></title>
	<description><![CDATA[<p><strong>splitbam</strong>&nbsp;splits a BAM by chromosomes.</p>
<p>Using the reference sequence dictionary (<code>*.dict</code>), it also creates some empty BAM files if no sam record was found for a chromosome. A pair of 'mock' SAM-Records can also be added to those empty BAMs to avoid some tools (like samtools) to crash.</p>
<h1>Usage</h1>
<p><code>java -jar splitbam.jar -p OUT/__CHROM__/__CHROM__.bam -R ref.fasta (bam|sam|stdin)</code></p>
<h1>Options</h1>
<ul>
<li>-h help; This screen.</li>
<li>-R (indexed reference file) REQUIRED.</li>
<li>-u (unmapped chromosome name): default:Unmapped</li>
<li>-e | --empty : generate EMPTY bams for chromosome having no read mapped</li>
<li>-m | --mock : if option '-e', add a mock pair of sam records to the empty bam</li>
<li>-p (output file/bam pattern) REQUIRED. MUST contain&nbsp;<strong><code>__CHROM__</code></strong>&nbsp;and end with .bam</li>
<li>-s assume input is sorted.</li>
<li>-x | --index create index.</li>
<li>-t | --tmp (dir) tmp file directory</li>
<li>-G (file) chrom-group file (see below)</li>
</ul><p>Address of the bookmark: <a href="https://code.google.com/archive/p/jvarkit/wikis/SplitBam.wiki" rel="nofollow">https://code.google.com/archive/p/jvarkit/wikis/SplitBam.wiki</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/31714/krona</guid>
	<pubDate>Wed, 22 Mar 2017 04:47:35 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/31714/krona</link>
	<title><![CDATA[Krona]]></title>
	<description><![CDATA[<p>Krona allows hierarchical data to be explored with zooming, multi-layered pie charts. Krona charts can be created using an <a href="https://github.com/marbl/Krona/wiki/ExcelTemplate">Excel template</a> or <a href="https://github.com/marbl/Krona/wiki/KronaTools">KronaTools</a>, which includes support for several bioinformatics tools and raw data formats. The interactive charts are self-contained and can be viewed with any modern web browser (see <a href="https://github.com/marbl/Krona/wiki/Browser%20support">Browser support</a>).</p>
<p><a href="http://marbl.github.io/Krona/img/screen_mgrast.png"><img src="https://camo.githubusercontent.com/27b71b1f1832523723c3d14dec764e7ad098438c/687474703a2f2f6d6172626c2e6769746875622e696f2f4b726f6e612f696d672f7468756d625f6d67726173742e706e67" width="210" height="167" alt="image" style="border: 0px;"></a></p><p>Address of the bookmark: <a href="https://github.com/marbl/Krona/wiki" rel="nofollow">https://github.com/marbl/Krona/wiki</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34235/quorum-an-error-corrector-for-illumina-reads</guid>
	<pubDate>Wed, 08 Nov 2017 11:40:41 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34235/quorum-an-error-corrector-for-illumina-reads</link>
	<title><![CDATA[QuorUM: An Error Corrector for Illumina Reads]]></title>
	<description><![CDATA[<p><span><span>Illumina Sequencing data can provide high coverage of a genome by relatively short (most often 100 bp to 150 bp) reads at a low cost. Even with low (advertised 1%) error rate, 100 &times; coverage Illumina data on average has an error in some read at every base in the genome. These errors make handling the data more complicated because they result in a large number of low-count erroneous&nbsp;</span><em>k</em><span>-mers in the reads. However, there is enough information in the reads to correct most of the sequencing errors, thus making subsequent use of the data (e.g. for mapping or assembly) easier. Here we use the term &ldquo;error correction&rdquo; to denote the reduction in errors due to both changes in individual bases and trimming of unusable sequence. We developed an error correction software called QuorUM. QuorUM is mainly aimed at error correcting Illumina reads for subsequent assembly. It is designed around the novel idea of minimizing the number of distinct erroneous&nbsp;</span><em>k</em><span>-mers in the output reads and preserving the most true&nbsp;</span><em>k</em><span>-mers, and we introduce a composite statistic &pi; that measures how successful we are at achieving this dual goal. We evaluate the performance of QuorUM by correcting actual Illumina reads from genomes for which a reference assembly is available.</span></span></p>
<p><span>QuorUM is distributed as an independent software package and as a module of the MaSuRCA assembly software. Both are available under the GPL open source license at&nbsp;</span><a href="http://www.genome.umd.edu/">http://www.genome.umd.edu</a><span>.</span></p><p>Address of the bookmark: <a href="http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0130821" rel="nofollow">http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0130821</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38563/hecil-a-hybrid-error-correction-algorithm-for-long-reads-with-iterative-learning</guid>
	<pubDate>Tue, 01 Jan 2019 12:01:00 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38563/hecil-a-hybrid-error-correction-algorithm-for-long-reads-with-iterative-learning</link>
	<title><![CDATA[HECIL: A Hybrid Error Correction Algorithm for Long Reads with Iterative Learning]]></title>
	<description><![CDATA[<p><span>HECIL&mdash;Hybrid Error Correction with Iterative Learning&mdash;a hybrid error correction framework that determines a correction policy for erroneous long reads, based on optimal combinations of decision weights obtained from short read alignments.&nbsp;</span></p>
<p><span><span>HECIL&rsquo;s core algorithm by introducing an iterative learning paradigm that enhances the correction policy at each iteration by incorporating knowledge gathered from previous iterations via data-driven confidence metrics assigned to prior corrections.</span></span></p><p>Address of the bookmark: <a href="https://github.com/NDBL/HECIL" rel="nofollow">https://github.com/NDBL/HECIL</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/42633/protocol-for-de-novo-genome-assembly-using-illumina-reads</guid>
	<pubDate>Sat, 16 Jan 2021 21:42:11 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/42633/protocol-for-de-novo-genome-assembly-using-illumina-reads</link>
	<title><![CDATA[Protocol for De novo Genome Assembly using Illumina Reads]]></title>
	<description><![CDATA[<p>In this protocol, we address and describe the de novo assembly method for small to medium-sized genomes.</p><p><strong>What is de novo genome assembly?<br /></strong>The method of taking a large number of short DNA sequences and placing them back together to create a reflection of the original chromosomes from which the DNA originated relates to genome assembly. No previous knowledge of the source DNA sequence length, structure or composition is inferred by De novo genome assemblies. The DNA of the target organism is split up into millions of tiny parts and read on a sequencing computer in a genome sequencing experiment. Depending on the sequencing system used, these "reads" range from 20 to 1000 nucleotide base pairs (bp) in length. Usually, length reads of 36 - 150 bp are produced for Illumina style short read sequencing. These reads can be either &ldquo;single ended&rdquo; as described above or &ldquo;paired end.&rdquo;</p><p><strong>Why genome assembly?</strong><br />In basic research into why and how they live, as well as in applied topics, identifying the DNA sequence of an organism is useful. Awareness of a DNA sequence may be useful in virtually any biological research because of the relevance of DNA to living things. For example, it may be used in medicine to classify, diagnose and eventually improve genetic disorder therapies. Similarly, pathogens study can lead to treatments for infectious diseases.</p><p><strong>Raw NGS data</strong><br />Reads can be saved as a Fasta file as text or in a FastQ file with their attributes.&nbsp;FastQ is the most common read file format since this is what the Illumina sequencing pipeline creates. This will henceforth be the subject of our conversation.</p><p><strong>In a nutshell the protocol:</strong> <br />Get the sequence file(s) read from the sequencing machine (s). <br />Look at the readings - have an idea of what you have and what the standard is like. <br />If required, raw data cleanup/quality trimming. <br />Choose an adequate parameter set for assembly. <br />Assemble the data into scaffolds/contigs. <br />Examine the assembly performance and determine the efficiency of the assembly.</p><p><strong>Read Quality Control:</strong><br />Check the qualiy with fastQC.<br />Script<br />https://bioinformaticsonline.com/snippets/view/42540/install-fastqc-using-conda</p><p>Quality trimming/cleanup of read files.<br />This function trims adapters, barcodes and other contaminants from the reads.<br />Script<br />https://bioinformaticsonline.com/snippets/view/42542/trimmomatic-command</p><p><strong>Genome Assembly:</strong><br />The object of this portion of the protocol is to explain the method of assembling the reads trimmed by quality into draft contigs.</p><blockquote><p>spades.py -1 illumina_R1.fastq.gz -2 illumina_R2.fastq.gz --careful --cov-cutoff auto -o result_of_spades_assembly_all_illumina</p></blockquote><p>A significant range of short-read assemblers are available. Everyone with strengths and disadvantages of their own. <br /><em>Some of the assemblers available include:</em><br />Velvet<br />SOAP-denovo<br />MIRA<br />ALLPATHS</p><p>Next step is to assess the suitability and what to do with a draft package of contiguous details for the remainder of the study now.&nbsp;Few stuff you can note about the contigs you just created:&nbsp;They're the draft Contigs. Any mis-assemblies can occur.</p><p><strong>Mis-assembly checking and assembly metric tools:</strong><br />QUAST - Quality assessment tool for genome assembly http://bioinf.spbau.ru/quast<br />Mauve assembly metrics - http://code.google.com/p/ngopt/wiki/How_To_Score_Genome_Assemblies_with_Mauve<br />InGAP-SV - https://sites.google.com/site/nextgengenomics/ingap and http://ingap.sourceforge.net/<br />inGAP is also useful for finding structural variants between genomes from read mappings.</p><p><strong>Genome finishing tools:</strong><br />Semi-automated gap fillers:<br />Gap filler - http://www.baseclear.com/landingpages/basetools-a-wide-range-of-bioinformatics-solutions/gapfiller/</p><p>IMAGE (V2) - http://sourceforge.net/apps/mediawiki/image2/index.php?title=Main_Page</p><p><strong>Genome visualisers and editors:</strong><br />Artemis - http://www.sanger.ac.uk/resources/software/artemis/<br />IGV - http://www.broadinstitute.org/igv/</p><p><strong>Automated and semi automated annotation tools:</strong><br />Prokka - https://github.com/tseemann/prokka<br />RAST - http://www.nmpdr.org/FIG/wiki/view.cgi/FIG/RapidAnnotationServer<br />JCVI Annotation Service - http://www.jcvi.org/cms/research/projects/annotation-service/</p><p><strong>Frequent command use for the analysis are at:</strong></p><p>https://bioinformaticsonline.com/blog/view/38765/list-of-tools-frequently-used-while-genome-assembly<br />https://bioinformaticsonline.com/pages/view/42275/frequent-parameters-for-bioinformatics-tools</p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44758/the-ifs-and-buts-of-ngs-quality-control-and-trimming</guid>
	<pubDate>Thu, 02 Jan 2025 20:11:07 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44758/the-ifs-and-buts-of-ngs-quality-control-and-trimming</link>
	<title><![CDATA[The &quot;Ifs&quot; and &quot;Buts&quot; of NGS Quality Control and Trimming]]></title>
	<description><![CDATA[<p>Next-Generation Sequencing (NGS) has revolutionized biological research, providing vast amounts of data for a wide range of applications. However, the reliability of NGS analyses heavily depends on the quality of raw sequencing data. Quality control (QC) and trimming are critical preprocessing steps that can make or break your downstream analyses. In this blog, we explore the "ifs" (why you should perform QC and trimming) and the "buts" (challenges or considerations) of this vital step in NGS workflows.</p><h3><strong>The "Ifs" of NGS QC and Trimming</strong></h3><ol>
<li>
<p><strong>Ensures Data Integrity</strong><br />If you want to minimize errors in downstream analyses, QC and trimming remove low-quality reads and bases, ensuring high-confidence data. This step is essential for reliable variant calling, assembly, and other applications.</p>
</li>
<li>
<p><strong>Removes Contaminants</strong><br />If adapter sequences or contaminants are present in the raw reads, trimming can eliminate them. This prevents issues like misalignment or incorrect biological interpretations, ensuring cleaner data for analysis.</p>
</li>
<li>
<p><strong>Improves Mapping and Assembly</strong><br />If your goal is better alignment to a reference genome or improved de novo assembly, trimming low-quality bases and adapters is critical. High-quality reads map more efficiently and generate more accurate assemblies.</p>
</li>
<li>
<p><strong>Reduces Computational Load</strong><br />If you want to save computational resources, trimming reduces the dataset size, which speeds up processing and analysis. Clean datasets mean less computational time spent on processing low-quality data.</p>
</li>
<li>
<p><strong>Prepares for Standardized Analyses</strong><br />If your project involves multiple datasets, QC and trimming ensure uniformity across them. This standardization makes comparisons valid and reproducible, particularly in large collaborative studies.</p>
</li>
</ol><h3><strong>The "Buts" of NGS QC and Trimming</strong></h3><ol>
<li>
<p><strong>Risk of Over-Trimming</strong><br />But excessive trimming can lead to the loss of informative sequences, reducing read depth and potentially discarding biologically relevant data. This is especially critical in studies with limited sequencing depth.</p>
</li>
<li>
<p><strong>Bias Introduction</strong><br />But trimming algorithms might introduce biases, especially if they inadvertently remove sequences with specific biological patterns. This can skew results and compromise biological insights.</p>
</li>
<li>
<p><strong>Loss of Context in Paired-End Reads</strong><br />But trimming one read in a pair more than the other can lead to loss of pairing information. This complicates downstream analyses that rely on paired-end data, such as structural variant detection.</p>
</li>
<li>
<p><strong>Time and Resource Intensive</strong><br />But running QC and trimming for large datasets can be computationally expensive and time-consuming. As sequencing depth increases, preprocessing becomes a bottleneck in the analysis pipeline.</p>
</li>
<li>
<p><strong>Variable Standards</strong><br />But the criteria for trimming (e.g., quality threshold, minimum read length) can vary between tools and datasets. This variability may affect reproducibility and comparability of results across studies.</p>
</li>
</ol><h3><strong>Balancing the "Ifs" and "Buts"</strong></h3><p>To maximize the benefits of QC and trimming while mitigating the challenges, consider the following best practices:</p><ul>
<li>
<p><strong>Use QC Tools Wisely:</strong> Start with tools like <strong>FastQC</strong> to identify quality issues in your raw data. Visualizing quality metrics helps tailor your trimming parameters.</p>
</li>
<li>
<p><strong>Choose Reliable Trimming Tools:</strong> Tools like <strong>Trimmomatic</strong>, <strong>Cutadapt</strong>, and <strong>BBduk</strong> offer adaptive and customizable trimming options. Select one that aligns with your dataset and project goals.</p>
</li>
<li>
<p><strong>Set Reasonable Parameters:</strong> Avoid over-trimming by setting quality thresholds and minimum read lengths that balance data retention and quality improvement.</p>
</li>
<li>
<p><strong>Test Downstream Effects:</strong> Validate the impact of QC and trimming on downstream analyses, such as alignment efficiency, variant calling accuracy, or assembly quality.</p>
</li>
<li>
<p><strong>Document Your Workflow:</strong> Maintain detailed records of the parameters and tools used for QC and trimming. This ensures reproducibility and enables better troubleshooting.</p>
</li>
</ul><h3><strong>Conclusion</strong></h3><p>NGS quality control and trimming are essential steps to ensure reliable and accurate data for analysis. While the "ifs" highlight the clear benefits of these steps, the "buts" remind us of the potential pitfalls. By adopting best practices and carefully balancing these considerations, you can optimize your preprocessing workflow and unlock the full potential of your sequencing data.</p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38310/sisrs-site-identification-from-short-read-sequences</guid>
	<pubDate>Wed, 28 Nov 2018 08:56:03 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38310/sisrs-site-identification-from-short-read-sequences</link>
	<title><![CDATA[SISRS: Site Identification from Short Read Sequences]]></title>
	<description><![CDATA[<p>Next-gen sequence data such as Illumina HiSeq reads. Data must be sorted into folders by taxon (e.g. species or genus). Paired reads in fastq format must be specified by _R1 and _R2 in the (otherwise identical) filenames. Paired and unpaired reads must have a fastq file extension.</p><p>Address of the bookmark: <a href="https://github.com/rachelss/SISRS" rel="nofollow">https://github.com/rachelss/SISRS</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>