BOL: Related items

Genetics for Fun and Profit: Andrew Hessel at TEDxVilnius

Sun, 01 Sep 2013 19:15:06 -0500

Andrew Hessel co-chairs the Bioinformatics and Biotechnology track at the Singularity University, an institution founded by futurist Ray Kurzweil and X Prize Foundation CEO Peter Diamandis, with sponsorship from world-leading organizations that include Google, Autodesk, and NASA. He is also the founder of the Pink Army Cooperative, a venture aiming to make open source personalized cancer therapies. His work has been featured in The New York Times, Futurist Magazine, H+, and Wired News. In the spirit of ideas worth spreading, TEDx is a program of local, self-organized events that bring people together to share a TED-like experience. At a TEDx event, TEDTalks video and live speakers combine to spark deep discussion and connection in a small group. These local, self-organized events are branded TEDx, where x = independently organized TED event. The TED Conference provides general guidance for the TEDx program, but individual TEDx events are self-organized.* (*Subject to certain rules and regulations)

Bioinformatics Scientist, Production Bioinformatics @ South San Francisco, CA

Thu, 19 Aug 2021 08:45:24 -0500

wist is looking for a Bioinformatics Scientist to join our Production Bioinformatics Team. You will work alongside research scientists, software engineers and data scientists to further deliver on our mission to expand access to best-in-class synthetic biology and next-generation sequencing applications. You will be developing and engineering tools to better evaluate and build hardened, production quality pipelines, optimize data quality, and automate lab and bioinformatics processes. Our ideal candidate is an organized problem solver with a background in developing and building novel production-quality bioinformatics tools and packages. Equally excellent communication skills and a proven ability to work independently are required.

More at https://boards.greenhouse.io/twistbioscience/jobs/3135495?gh_src=9ecc0b941us

Amity University Bioinformatics Summer Program - Kolkata

eliabrodsky — Tue, 11 Jun 2019 21:27:10 -0500

Registrations are now open for the 2019 Summer Bioinformatics Training program at Amity University, Kolkata. The program will focus on introductory topics for life science students. We will review important history, topics and challenges bioinformatics can help address in the context of basic research, discovery and industry.

Read more: https://edu.t-bio.info/amity-university-summer-bioinformatics-program-registrations-are-open/

BioGeek Fun

Jit — Sun, 16 Mar 2014 06:33:31 -0500

1. A futuristic computational biology student was told to write "It is in my gene!!!" on the board 100 times as a punishment. here's his response -

use warnings;
for ($count=1; $count <=100; $count++) { print "It is in my gene!!!";}

I guess, he is gonna to be a real biogeek. Nice try though. Smart kid.

2. In some perl script I found this
. . . . . .
. . . . . .
# It works for me, only God understood how it is working
while (/(<\/[^>]+>)|(<[^>]+>)|(<[^>]+>)$|([^><]+)/go) {
            $startGene=$1;
            $beginChromosome=$2;

. . . . . .
.. . . . . .
}

3. One more interesting message in Perl found …. It will must tickle you bone :)
open(my $fh, "<", "gene.txt") or kill " Me if you think this is a mistake :$!";

4. From the Perl

while () { # "The Mothership Connection is here!"
print “$_\n”; # Printing the offspring :)

5. Perl message
if ($1) { print “Just found a the error in chromosome !!!, yahoo…”; else { “That is not error, but mutation you moron!”;

6. One genome database curator walk in wine bar asked the bartender:
CREATE TABLE gene IF NOT EXISTS SexOnTheBeach;

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

Clump Finding Problem Solved with Perl

Jit — Wed, 10 Jun 2015 00:17:17 -0500

The question at http://rosalind.info/problems/1d/

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Genome Browser : GBrowse

Jit — Fri, 19 Feb 2016 09:22:43 -0600

Generic Genome Browser Version 2: A Tutorial for Administrators

This is an extensive tutorial to take you through the main features and gotchas of configuring GBrowse as a server. This tutorial assumes that you have successfully set up Perl, GD, BioPerl and the other GBrowse dependencies. If you haven't, please see the GBrowse HOWTO During most of the tutorial, we will be using the "in-memory" GBrowse database (no relational database required!) Later we will show how to set up a genome size database using the berkeleydb and MySQL adaptors.

More at http://elp.ucdavis.edu/tutorial/tutorial.html

Address of the bookmark: http://elp.ucdavis.edu/tutorial/tutorial.html

Life of BI !!!

Jitendra Narayan — Thu, 22 Aug 2013 16:13:36 -0500

Hmm .. Don't worry you read it right .. this is not pi but bi ... "life of Bioinformatician(BI)".

Disclaimer: This cartoon is solely designed to create humour and fun, not to offend any PI, supervisor or student.

Golden Rules of Bioinformatics

Jitendra Narayan — Wed, 14 Aug 2013 21:11:33 -0500

All constant are variable.
Copy and paste is a genetic error.
First solve the problem, then write the code.
No matter what goes wrong, it will probably look right.
Any simple problem can be insoluble if enough metting are held to discuss it. :P
Stastics is a systematic method of comming to the wrong conclusion with confidence.
Bug is a undocumented feature in programming languages.
Good biological programmer goes on summer holiday with raincoat. [because see 1]
Thanks god Google know python is not a python and multiplication and division are the same thing.
Don' be clever, complex biology will trick you.