<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/38029?offset=30</link>
	<atom:link href="https://bioinformaticsonline.com/related/38029?offset=30" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/21703/coding-ground</guid>
	<pubDate>Tue, 17 Mar 2015 00:47:20 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/21703/coding-ground</link>
	<title><![CDATA[Coding Ground]]></title>
	<description><![CDATA[<p>Online coding group for most of the programming languages.</p>
<p>Code in almost all popular languages using Coding Ground.&nbsp;Edit, compile, execute and share your projects, 100% cloud.</p>
<p>http://www.tutorialspoint.com/codingground.htm</p><p>Address of the bookmark: <a href="http://www.tutorialspoint.com/codingground.htm" rel="nofollow">http://www.tutorialspoint.com/codingground.htm</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/30336/finding-patterns-in-biological-sequences</guid>
	<pubDate>Thu, 22 Dec 2016 10:30:49 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/30336/finding-patterns-in-biological-sequences</link>
	<title><![CDATA[Finding Patterns in Biological Sequences]]></title>
	<description><![CDATA[<p>In this report we provide an overview of known techniques for discovery of patterns of biological sequences (DNA and proteins). We also provide biological motivation, and methods of biological verification of such patterns. Finally we list publicly available tools and databases for pattern discovery. On-line supplement is available through http://genetics.uwaterloo.ca/&sim;tvinar/cs798g/motif.</p><p>Address of the bookmark: <a href="http://engr.case.edu/li_jing/papers/00798gpattern.pdf" rel="nofollow">http://engr.case.edu/li_jing/papers/00798gpattern.pdf</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/2534/bioinformatician-needs-ten-heads</guid>
	<pubDate>Sat, 17 Aug 2013 10:30:45 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/2534/bioinformatician-needs-ten-heads</link>
	<title><![CDATA[Bioinformatician needs ten heads !!!]]></title>
	<description><![CDATA[<p>Bioinformatics demands more and ... lots more knowledge. In this case Ravan, a mythological character from the Ramayan, can only be a real bioinformatician. :) :P</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/2534" length="90547" type="image/jpeg" />
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/41905/research-associate-bioinformatics-in-iisc-recruitment-2020</guid>
  <pubDate>Tue, 23 Jun 2020 21:53:34 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Associate Bioinformatics in IISc Recruitment 2020]]></title>
  <description><![CDATA[
<p>Research Associate Bioinformatics in IISc Recruitment 2020</p>

<p>Essential Qualifications: Ph.D. (Bioinformatics/ Biophysics/ Biotechnology or any other stream of biological/ physical sciences) with a minimum of two publications in reputed peer reviewed journals in the area of structural bioinformatics or biophysics or biomolecular modeling/ simulation.</p>

<p>Job description: Development of bioinformatics tools and algorithms/software for structure based analysis of biomolecular systems. Programmatic access to major biomolecular databases using APIs Knowledge based prediction and analysis of biomolecular structure, function and interactions. Docking/simulations for inhibitor design.</p>

<p>Desirable Qualifications (Research Associate/s): i)  Strong computer programming skills (in Python/PERL/PHP or C++ or object oriented database management systems like MySQL etc or scripting languages under LINUX/UNIX environment). </p>

<p>ii) Extensive experience in computational analysis of biomolecular structure/interactions and usage of advanced biomolecular simulation softwares. iii) Adequate knowledge of major databases, webservers and softwares in the area of biomolecular structure/function and drug design. iv)  Familiarity with Parallel Programming environments and experience in usage of high-end HPC clusters.</p>

<p>The candidates must highlight their experience in above mentioned fields/topics in their CV. Initial appointment will be for a period of 1 year, subject to extension after review of performance.</p>

<p>Emoluments: As per DST, GOI norms and commensurate with experience.</p>

<p>More at https://www.iisc.ac.in/positions-open/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/4482/bioinformatics-definitions-and-applications</guid>
	<pubDate>Thu, 12 Sep 2013 15:04:36 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/4482/bioinformatics-definitions-and-applications</link>
	<title><![CDATA[Bioinformatics definitions and applications !!!]]></title>
	<description><![CDATA[<p>There have been long discussion amongst several specialized/expert educator regarding bioinformatics arena, but everyone explain bioinformatics with their own view. I tried to explain it with a cartoon. Hope you all will like it.</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/4482" length="49464" type="image/gif" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/7032/computer-experts-in-biotechnology-laboratory</guid>
	<pubDate>Wed, 04 Dec 2013 02:11:43 -0600</pubDate>
	<link>https://bioinformaticsonline.com/file/view/7032/computer-experts-in-biotechnology-laboratory</link>
	<title><![CDATA[Computer experts in biotechnology laboratory]]></title>
	<description><![CDATA[<p>Only bioinformatician can understand that <strong>multiplication</strong> and <strong>division</strong> are different but same thing :)</p><p><span>Disclaimer:</span>&nbsp;This cartoon is solely designed to create humour and fun, not to offend any computer experts.</p>]]></description>
	<dc:creator>Jit</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/7032" length="35726" type="image/gif" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22569/reverse-complement-problem-solved-with-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:37:23 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22569/reverse-complement-problem-solved-with-perl</link>
	<title><![CDATA[Reverse Complement Problem Solved with Perl]]></title>
	<description><![CDATA[<p>Question at http://rosalind.info/problems/1b/</p><p>#Find the reverse complement of a DNA string.<br />#Given: A DNA string Pattern.<br />#Return: Pattern, the reverse complement of Pattern.<br /><br />use strict;<br />use warnings;<br /><br />my $string="AAAACCCGGT";<br />my $finalString="";<br />my %hash = (<br />&nbsp;&nbsp; &nbsp;"C" =&gt; "G", <br />&nbsp;&nbsp; &nbsp;"A" =&gt; "T", <br />&nbsp;&nbsp; &nbsp;"T" =&gt; "A", <br />&nbsp;&nbsp; &nbsp;"G" =&gt; "C",<br />);<br /><br />for (my $aa=0; $aa&lt;=(length($string)-1); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $char=substr $string, $aa, 1;<br />&nbsp;&nbsp; &nbsp;#print $hash{$char};<br />&nbsp;&nbsp; &nbsp;$finalString="$hash{$char}"."$finalString";<br />}<br /><br />print $finalString;<br />print "\n";</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>