BOL: Related items

Perl One liner basics !!

Abhimanyu Singh — Sun, 24 May 2015 09:28:33 -0500

Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:

$ perl -e 'print "Hello, World!\n"'
Hello, World!

It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.

I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?

$ perl -e 'print "$^O\n"'
linux

It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:

$ perl -E 'say "$^O"'
linux

Pretty handy! say is a nifty feature that you'll use again and again.

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

Clump Finding Problem Solved with Perl

Jit — Wed, 10 Jun 2015 00:17:17 -0500

The question at http://rosalind.info/problems/1d/

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Finding Patterns in Biological Sequences

Jit — Thu, 22 Dec 2016 10:30:49 -0600

In this report we provide an overview of known techniques for discovery of patterns of biological sequences (DNA and proteins). We also provide biological motivation, and methods of biological verification of such patterns. Finally we list publicly available tools and databases for pattern discovery. On-line supplement is available through http://genetics.uwaterloo.ca/∼tvinar/cs798g/motif.

Address of the bookmark: http://engr.case.edu/li_jing/papers/00798gpattern.pdf

Bioinformatician needs ten heads !!!

Jitendra Narayan — Sat, 17 Aug 2013 10:30:45 -0500

Bioinformatics demands more and ... lots more knowledge. In this case Ravan, a mythological character from the Ramayan, can only be a real bioinformatician. :) :P

Research Associate Bioinformatics in IISc Recruitment 2020

Tue, 23 Jun 2020 21:53:34 -0500

Research Associate Bioinformatics in IISc Recruitment 2020

Essential Qualifications: Ph.D. (Bioinformatics/ Biophysics/ Biotechnology or any other stream of biological/ physical sciences) with a minimum of two publications in reputed peer reviewed journals in the area of structural bioinformatics or biophysics or biomolecular modeling/ simulation.

Job description: Development of bioinformatics tools and algorithms/software for structure based analysis of biomolecular systems. Programmatic access to major biomolecular databases using APIs Knowledge based prediction and analysis of biomolecular structure, function and interactions. Docking/simulations for inhibitor design.

Desirable Qualifications (Research Associate/s): i) Strong computer programming skills (in Python/PERL/PHP or C++ or object oriented database management systems like MySQL etc or scripting languages under LINUX/UNIX environment).

ii) Extensive experience in computational analysis of biomolecular structure/interactions and usage of advanced biomolecular simulation softwares. iii) Adequate knowledge of major databases, webservers and softwares in the area of biomolecular structure/function and drug design. iv) Familiarity with Parallel Programming environments and experience in usage of high-end HPC clusters.

The candidates must highlight their experience in above mentioned fields/topics in their CV. Initial appointment will be for a period of 1 year, subject to extension after review of performance.

Emoluments: As per DST, GOI norms and commensurate with experience.

More at https://www.iisc.ac.in/positions-open/

Bioinformatics definitions and applications !!!

Jit — Thu, 12 Sep 2013 15:04:36 -0500

There have been long discussion amongst several specialized/expert educator regarding bioinformatics arena, but everyone explain bioinformatics with their own view. I tried to explain it with a cartoon. Hope you all will like it.

Computer experts in biotechnology laboratory

Jit — Wed, 04 Dec 2013 02:11:43 -0600

Only bioinformatician can understand that multiplication and division are different but same thing :)

Disclaimer: This cartoon is solely designed to create humour and fun, not to offend any computer experts.

Reverse Complement Problem Solved with Perl

Jit — Tue, 09 Jun 2015 23:37:23 -0500

Question at http://rosalind.info/problems/1b/

#Find the reverse complement of a DNA string.
#Given: A DNA string Pattern.
#Return: Pattern, the reverse complement of Pattern.

use strict;
use warnings;

my $string="AAAACCCGGT";
my $finalString="";
my %hash = (
   "C" => "G",
   "A" => "T",
   "T" => "A",
   "G" => "C",
);

for (my $aa=0; $aa<=(length($string)-1); $aa++) {
   my $char=substr $string, $aa, 1;
   #print $hash{$char};
   $finalString="$hash{$char}"."$finalString";
}

print $finalString;
print "\n";

SRF/JRF Bioinformatics at CIARI

Fri, 04 Dec 2015 00:10:09 -0600

Realizing the importance of Island Agriculture to meet the requirements of local population and tourists, Indian Council of Agricultural research (ICAR) established Central Island Agricultural Research Institute, Port Blair on June 23rd, 1978 by merging different regional research stations of ICAR institutes located in Islands. The ultimate aim of CIARI is the developments of island agricultural production technologies which utilizes the strengths of the island and convert the constraints in opportunities, without causing any ill effect to the fragile ecosystem of the island.The institute has made tremendous progress in the Agriculture development of the islands during the last three decades. Keeping in view the natural resources of the islands diversity, fragile ecosystem, research program would be designed to maximize the productivity without disturbing to the islands ecosystem to provide better and decent livelihood and as a source of revenue and resource generation. Research and development in Agriculture sector should cover all disciplines in order to have a balanced progress in all disciplines for the overall benefits of the farmers of these islands.

Position I

Job Title : Junior Research Fellow

No. of Posts : One

Project : Establishment of sub distributed information centre

Qualification : M.Sc in Basic Science with NET or B.Sc in professional course with NET or M.Sc in professional course

Desired Experience : Experience in Bioinformatics and molecular biology

Payscale : Rs. 25000 per month

Age Limit : Upto 35 for men and 40 for women with 5 years relaxation to SC/ST and 3 years relaxation for OBC.

Position II

Job Title : Traineeship

No. of Posts : One

Project : Establishment of sub distributed information centre

Qualification : B.Sc Bioinformatics /Biotechnology / Life Science / Computer Science

Desired Experience : Experience in Bioinformatics and molecular biology

Payscale : Rs. 8000 per month

Age Limit : Upto 35 for men and 40 for women with 5 years relaxation to SC/ST and 3 years relaxation for OBC.

Position III

Job Title : Studentship

No. of Posts : Two

Project : Establishment of sub distributed information centre

Qualification : B.Sc Bioinformatics /Biotechnology / Life Science / Computer Science

Desired Experience : Experience in Bioinformatics and molecular biology

Payscale : Rs. 8000 per month

Age Limit : Upto 35 for men and 40 for women with 5 years relaxation to SC/ST and 3 years relaxation for OBC.

How to Apply : Candidates who meet the requirements can attend the walk in interview at CIARI,Port Blair on 09.12.2015 10.30AM.

http://icar-ciari.res.in/employment/9-12-15.pdf