Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

This is an extensive tutorial to take you through the main features and gotchas of configuring GBrowse as a server. This tutorial assumes that you have successfully set up Perl, GD, BioPerl and the other GBrowse dependencies. If you haven't, please see the GBrowse HOWTO During most of the tutorial, we will be using the "in-memory" GBrowse database (no relational database required!) Later we will show how to set up a genome size database using the berkeleydb and MySQL adaptors.

More at http://elp.ucdavis.edu/tutorial/tutorial.html

Address of the bookmark: http://elp.ucdavis.edu/tutorial/tutorial.html

Address of the bookmark: http://engr.case.edu/li_jing/papers/00798gpattern.pdf

Essential Qualifications: Ph.D. (Bioinformatics/ Biophysics/ Biotechnology or any other stream of biological/ physical sciences) with a minimum of two publications in reputed peer reviewed journals in the area of structural bioinformatics or biophysics or biomolecular modeling/ simulation.

Job description: Development of bioinformatics tools and algorithms/software for structure based analysis of biomolecular systems. Programmatic access to major biomolecular databases using APIs Knowledge based prediction and analysis of biomolecular structure, function and interactions. Docking/simulations for inhibitor design.

Desirable Qualifications (Research Associate/s): i) Strong computer programming skills (in Python/PERL/PHP or C++ or object oriented database management systems like MySQL etc or scripting languages under LINUX/UNIX environment).

ii) Extensive experience in computational analysis of biomolecular structure/interactions and usage of advanced biomolecular simulation softwares. iii) Adequate knowledge of major databases, webservers and softwares in the area of biomolecular structure/function and drug design. iv) Familiarity with Parallel Programming environments and experience in usage of high-end HPC clusters.

The candidates must highlight their experience in above mentioned fields/topics in their CV. Initial appointment will be for a period of 1 year, subject to extension after review of performance.

Emoluments: As per DST, GOI norms and commensurate with experience.

More at https://www.iisc.ac.in/positions-open/

Disclaimer: This cartoon is solely designed to create humour and fun, not to offend any computer experts.

#Find the reverse complement of a DNA string.
#Given: A DNA string Pattern.
#Return: Pattern, the reverse complement of Pattern.

use strict;
use warnings;

my $string="AAAACCCGGT";
my $finalString="";
my %hash = (
    "C" => "G",
    "A" => "T",
    "T" => "A",
    "G" => "C",
);

for (my $aa=0; $aa<=(length($string)-1); $aa++) {
    my $char=substr $string, $aa, 1;
    #print $hash{$char};
    $finalString="$hash{$char}"."$finalString";
}

print $finalString;
print "\n";

Address of the bookmark: https://www.cog-genomics.org/plink2/