<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/38041?offset=320</link>
	<atom:link href="https://bioinformaticsonline.com/related/38041?offset=320" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</guid>
	<pubDate>Thu, 31 May 2018 06:00:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</link>
	<title><![CDATA[CrossMap: a program for convenient conversion of genome coordinates]]></title>
	<description><![CDATA[CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) &lt;&gt; hg19 (GRCh37), Mouse mm9 (MGSCv37) &lt;&gt; mm10 (GRCm38)).

It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF.

CrossMap is designed to liftover genome coordinates between assemblies. 

It’s not a program for aligning sequences to reference genome.

We do not recommend using CrossMap to convert genome coordinates between species.<p>Address of the bookmark: <a href="http://crossmap.sourceforge.net" rel="nofollow">http://crossmap.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</guid>
	<pubDate>Fri, 20 Jul 2018 10:03:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</link>
	<title><![CDATA[Converting a VCF into a FASTA given some reference !]]></title>
	<description><![CDATA[<p>Samtools/BCFtools (Heng Li) provides a Perl script&nbsp;<a href="https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl"><code>vcfutils.pl</code></a>&nbsp;which does this, the function&nbsp;<code>vcf2fq</code>&nbsp;(lines 469-528)</p><p>This script has been modified by others to convert InDels as well, e.g.&nbsp;<a href="https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl">this</a>&nbsp;by David Eccles</p><pre><code><span>./</span><span>vcf2fq</span><span>.</span><span>pl </span><span>-</span><span>f </span><span>&lt;</span><span>input</span><span>.</span><span>fasta</span><span>&gt;</span><span> </span><span>&lt;</span><span>all</span><span>-</span><span>site</span><span>.</span><span>vcf</span><span>&gt;</span><span> </span><span>&gt;</span><span> </span><span>&lt;</span><span>output</span><span>.</span><span>fastq</span><span>&gt;</span></code></pre><p>https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl</p><p>https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37650/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</guid>
	<pubDate>Fri, 07 Sep 2018 05:19:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37650/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</link>
	<title><![CDATA[P_RNA_scaffolder: a fast and accurate genome scaffolder using paired-end RNA-sequencing reads]]></title>
	<description><![CDATA[<p><span>P_RNA_scaffolder is a novel scaffolding tool using Pair-end RNA-seq to scaffold genome fragments. The method is suitable for most genomes. The program could utilize Illumina Paired-end RNA-sequencing reads from target speciesies. Our method provides another practical alternative to existing mate-pair_based approaches or other Protein-based approaches (for instance,&nbsp;</span><a href="http://www.fishbrowser.org/software/PEP_scaffolder/">PEP_scaffolder&nbsp;</a><span>) for scaffolding genome sequences. The most important feature of this method is to improve the completeness of gene regions and long-coding gene regions (for instance,&nbsp;</span><a href="http://circrna.org/">circRNA</a><span>).</span></p><p>Address of the bookmark: <a href="http://www.fishbrowser.org/software/P_RNA_scaffolder/#" rel="nofollow">http://www.fishbrowser.org/software/P_RNA_scaffolder/#</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</guid>
	<pubDate>Thu, 25 Oct 2018 09:38:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</link>
	<title><![CDATA[Scribl : HTML5 canvas genomics graphic library]]></title>
	<description><![CDATA[<p>Scribl is a javascript, Canvas-based graphics library that easily generates biological visuals of genomic regions, alignments, and assembly data. Scribl can also be used in conventional offline pipelines, since everything needed to generate charts can be contained in a single html file.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="http://chmille4.github.io/Scribl/" rel="nofollow">http://chmille4.github.io/Scribl/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38166/pygenometracks-standalone-program-and-library-to-plot-beautiful-genome-browser-tracks</guid>
	<pubDate>Fri, 09 Nov 2018 12:34:23 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38166/pygenometracks-standalone-program-and-library-to-plot-beautiful-genome-browser-tracks</link>
	<title><![CDATA[pyGenomeTracks: Standalone program and library to plot beautiful genome browser tracks]]></title>
	<description><![CDATA[<p>pyGenomeTracks aims to produce high-quality genome browser tracks that are highly customizable. Currently, it is possible to plot:</p>
<ul>
<li>bigwig</li>
<li>bed (many options)</li>
<li>bedgraph</li>
<li>links (represented as arcs)</li>
<li>Hi-C matrices (if&nbsp;<a href="http://hicexplorer.readthedocs.io/">HiCExplorer</a>&nbsp;is installed)</li>
</ul><p>Address of the bookmark: <a href="https://github.com/deeptools/pyGenomeTracks" rel="nofollow">https://github.com/deeptools/pyGenomeTracks</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38443/genoplotr-plot-gene-and-genome-maps-project</guid>
	<pubDate>Wed, 12 Dec 2018 08:33:41 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38443/genoplotr-plot-gene-and-genome-maps-project</link>
	<title><![CDATA[genoPlotR - plot gene and genome maps project!]]></title>
	<description><![CDATA[<p>genoPlotR is a R package to produce reproducible, publication-grade graphics of gene and genome maps. It allows the user to read from usual format such as protein table files and blast results, as well as home-made tabular files.</p>
<h3>Features</h3>
<ul>
<li>Linear representation of several segments of DNA</li>
<li>Comparisons represented by areas between the segments (like Artemis, for example)</li>
<li>Reads from common formats: Genbank, EMBL, blast, Mauve, and from user-generated tab files</li>
<li>Plot several subsegments of the same segment on the same line, separated by a //</li>
<li>Automatic or manual placement of the segments on the plot</li>
<li>Add annotations to all the lines</li>
<li>Create smart, automatic annotations for genomes, based on gene names</li>
<li>Add a user-generated tree</li>
<li>Add a global scale or a scale to each line</li>
<li>Use user-defined graphical functions to represent genes</li>
<li></li>
</ul><p>Address of the bookmark: <a href="http://genoplotr.r-forge.r-project.org/" rel="nofollow">http://genoplotr.r-forge.r-project.org/</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/38618/canu-genome-assembly-parameters</guid>
	<pubDate>Mon, 07 Jan 2019 08:40:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/38618/canu-genome-assembly-parameters</link>
	<title><![CDATA[CANU genome assembly parameters !]]></title>
	<description><![CDATA[<p>Choose the appropriate parameters to run Canu and run it. The assembly will take about an hour. You can use two cores (parameter&nbsp;<code>-maxThreads=2</code>) and you would like to disable cluster option, since we compute on a single Amazon server set off the option to compute on cluster&nbsp;<code>useGrid=false</code>. This specifications should be for your project discussed with a local computing guru. The parameters that are in square brackets&nbsp;<code>[]</code>&nbsp;are optional, symbol&nbsp;<code>|</code>&nbsp;stands for "or".</p><pre><code>usage:   canu [-correct | -trim | -assemble | -trim-assemble] \
              [-s ] \
               -p  \
               -d  \
               genomeSize=[g|m|k] \
               -maxThreads=2 \
               useGrid=false \
              [other-options] \
               read_file.fastq.gz
</code></pre><p>A default&nbsp;<code>Canu</code>&nbsp;run produces usually high quality assembly, example of a command that was used for testing can be found below. However, there are still a lot of parameters that are possible to tweak. For example if we desire to assemble haplotypes separately of if we want to smash them together, we can alternate the error correction process.</p><pre><code>canu -p test_asmbl \
     -d asm_test3 \
     genomeSize=2m \
     -maxThreads=2 useGrid=false \
     -pacbio-raw \ ~/pacbio/dna/sample_reads.fastq.gz</code></pre><p>There is a brilliant&nbsp;<a href="http://canu.readthedocs.io/en/latest/faq.html#what-parameters-can-i-tweak">section in documentation</a>&nbsp;about parameter tweaking.</p><p>The output directory contains will contain many files. The most interesting ones are:</p><ul>
<li><code>*.correctedReads.fasta.gz</code>&nbsp;: file containing the input sequences after correction, trim and split based on consensus evidence.</li>
<li><code>*.trimmedReads.fastq</code>&nbsp;: file containing the sequences after correction and final trimming</li>
<li><code>*.layout</code>&nbsp;: file containing informations about read inclusion in the final assembly</li>
<li><code>*.gfa</code>&nbsp;: file containing the assembly graph by Canu</li>
<li><code>*.contigs.fasta</code>&nbsp;: file containing everything that could be assembled and is part of the primary assembly</li>
</ul><p>The basic stats of assembly can be read from reports generated by the assembler, or calculated using standard UNIX command line tools.</p><p>More at&nbsp;https://canu.readthedocs.io/en/latest/faq.html</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38886/evaluation-of-genome-assembly-software-based-on-long-reads</guid>
	<pubDate>Fri, 01 Feb 2019 11:55:54 -0600</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38886/evaluation-of-genome-assembly-software-based-on-long-reads</link>
	<title><![CDATA[Evaluation of genome assembly software based on long reads]]></title>
	<description><![CDATA[<p>TGS technologies have been used to produce highly accurate de novo assemblies of hundreds of microbial genomes and highly contiguous reconstructions of many dozens of plant and animal genomes, enabling new insights into evolution and sequence diversity. They have also been applied to resequencing analyses, to create detailed maps of structural variations in many species. Also, these new technologies have been used to fill in many of the gaps in the human reference genome.</p><p>In this report, we compare and evaluate several genome assembly software based on TSG technology. The experimentation has been performed on 4 reference genomes and the results evaluated with the QUAST software. The 11 software that have been evaluated are: Celera Assembler , Falcon , Miniasm, Newbler , SGA Assembler, Smartdenovo, Abruijn, Ra, DBG2OLC, Spades and Cerulean. The first 8 software use only long reads, while the 3 last software can merge long and short reads</p>]]></description>
	<dc:creator>BioStar</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38886" length="382699" type="application/pdf" />
</item>

</channel>
</rss>