Key Features of BLAST:
1. Sequence Comparison: BLAST searches for local alignments between the query sequence and sequences in a database. It identifies regions of similarity, which can help infer functional and evolutionary relationships.

2. Speed and Efficiency: BLAST uses heuristic algorithms, making it faster than exhaustive search methods, suitable for large-scale database searches.

3. Versatility: There are several versions of BLAST for different types of sequence comparisons:
- blastn: Compares a nucleotide query sequence against a nucleotide sequence database.
- blastp: Compares a protein query sequence against a protein sequence database.
- blastx: Compares a nucleotide query sequence translated in all reading frames against a protein sequence database.
- tblastn: Compares a protein query sequence against a nucleotide sequence database translated in all reading frames.
- tblastx: Compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database.

4. Scoring and E-value: BLAST results are scored based on the quality and length of the alignments. The E-value (expect value) indicates the number of alignments one can expect to find by chance, with lower E-values representing more significant matches.

5. Output Formats: BLAST provides results in various formats, including plain text, HTML, XML, and JSON, making it adaptable for different types of analyses and integrations with other tools.

Applications of BLAST:
- Genomic Research: Identifying genes, understanding genetic diversity, and mapping genome sequences.
- Protein Function Prediction: Inferring the function of unknown proteins by comparing them to known protein sequences.
- Evolutionary Studies: Exploring evolutionary relationships between organisms by comparing their genetic material.
- Medical Research: Identifying pathogens, understanding disease mechanisms, and developing treatments by comparing sequences of interest.

Overall, BLAST is an essential tool in bioinformatics, offering a reliable and efficient way to analyze and interpret biological sequence data.

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

The changes in nr preserve the taxonomic diversity of the entries in the database while reducing the number of titles for identical sequences. GenPept accessions are still accessible via www.ncbi.nlm.nih.gov/protein/$GENBANK_ACCESSION or the IPG website https://www.ncbi.nlm.nih.gov/ipg/.

The "Identical Proteins" link in the alignments section of the webBLAST results takes you to a full list of all accessions associated with a sequence.

For BLAST+ users downloading nr_v5: the database is now approximately 50% smaller, resulting in faster downloads and BLAST searches, and smaller disk space requirements. The database is downloadable at:  ftp://ftp.ncbi.nlm.nih.gov/blast/db/v5/

For BLAST+ there is a cleanup script to help you manage the transition to this smaller database. The script removes unused database volumes: ftp://ftp.ncbi.nlm.nih.gov/blast/temp/cleanup-blastdb-volumes.py

Here are the new rules on how we keep titles in nr_v5:

1.    We keep all refseq, swissprot, pir and PDB titles.

2.    We keep any GenPept titles with a TAXID that has not already been seen in the record.

3.    We keep at least five GenPept titles regardless of whether the TAXIDS have been seen before or not in this record.

The biggest and perhaps most fearsome of the world's big cats, the tiger, shares 95.6 percent of its DNA with humans' cute and furry companions, domestic cats.

The new research showed that big cats have genetic mutations that enabled them to be carnivores. The team also identified mutations that allow snow leopards to thrive at high altitudes.

Reference:

http://www.nbcnews.com/science/your-cat-ferocious-tigers-share-lot-95-6-percent-their-4B11182690

http://timesofindia.indiatimes.com/home/environment/flora-fauna/Gene-mapping-of-tiger-completed/articleshow/22671681.cms

Paper:

http://www.nature.com/ncomms/2013/130917/ncomms3433/full/ncomms3433.html

http://en.wikipedia.org/wiki/Sequence_assembly 

https://genomebiology.biomedcentral.com/articles/10.1186/s13059-016-0951-y

Address of the bookmark: https://sourceforge.net/projects/operasf/

Again, running spades.py will show you the options:

spades.py

This produces:

SPAdes genome assembler v3.10.1

Usage: /usr/local/SPAdes-3.10.1-Linux/bin/spades.py [options] -o <output_dir>

Basic options:
-o      <output_dir>    directory to store all the resulting files (required)
--sc                    this flag is required for MDA (single-cell) data
--meta                  this flag is required for metagenomic sample data
--rna                   this flag is required for RNA-Seq data
--plasmid               runs plasmidSPAdes pipeline for plasmid detection
--iontorrent            this flag is required for IonTorrent data
--test                  runs SPAdes on toy dataset
-h/--help               prints this usage message
-v/--version            prints version

Input data:
--12    <filename>      file with interlaced forward and reverse paired-end reads
-1      <filename>      file with forward paired-end reads
-2      <filename>      file with reverse paired-end reads
-s      <filename>      file with unpaired reads
--pe<#>-12      <filename>      file with interlaced reads for paired-end library number <#> (<#> = 1,2,..,9)
--pe<#>-1       <filename>      file with forward reads for paired-end library number <#> (<#> = 1,2,..,9)
--pe<#>-2       <filename>      file with reverse reads for paired-end library number <#> (<#> = 1,2,..,9)
--pe<#>-s       <filename>      file with unpaired reads for paired-end library number <#> (<#> = 1,2,..,9)
--pe<#>-<or>    orientation of reads for paired-end library number <#> (<#> = 1,2,..,9; <or> = fr, rf, ff)
--s<#>          <filename>      file with unpaired reads for single reads library number <#> (<#> = 1,2,..,9)
--mp<#>-12      <filename>      file with interlaced reads for mate-pair library number <#> (<#> = 1,2,..,9)
--mp<#>-1       <filename>      file with forward reads for mate-pair library number <#> (<#> = 1,2,..,9)
--mp<#>-2       <filename>      file with reverse reads for mate-pair library number <#> (<#> = 1,2,..,9)
--mp<#>-s       <filename>      file with unpaired reads for mate-pair library number <#> (<#> = 1,2,..,9)
--mp<#>-<or>    orientation of reads for mate-pair library number <#> (<#> = 1,2,..,9; <or> = fr, rf, ff)
--hqmp<#>-12    <filename>      file with interlaced reads for high-quality mate-pair library number <#> (<#> = 1,2,..,9)
--hqmp<#>-1     <filename>      file with forward reads for high-quality mate-pair library number <#> (<#> = 1,2,..,9)
--hqmp<#>-2     <filename>      file with reverse reads for high-quality mate-pair library number <#> (<#> = 1,2,..,9)
--hqmp<#>-s     <filename>      file with unpaired reads for high-quality mate-pair library number <#> (<#> = 1,2,..,9)
--hqmp<#>-<or>  orientation of reads for high-quality mate-pair library number <#> (<#> = 1,2,..,9; <or> = fr, rf, ff)
--nxmate<#>-1   <filename>      file with forward reads for Lucigen NxMate library number <#> (<#> = 1,2,..,9)
--nxmate<#>-2   <filename>      file with reverse reads for Lucigen NxMate library number <#> (<#> = 1,2,..,9)
--sanger        <filename>      file with Sanger reads
--pacbio        <filename>      file with PacBio reads
--nanopore      <filename>      file with Nanopore reads
--tslr  <filename>      file with TSLR-contigs
--trusted-contigs       <filename>      file with trusted contigs
--untrusted-contigs     <filename>      file with untrusted contigs

Pipeline options:
--only-error-correction runs only read error correction (without assembling)
--only-assembler        runs only assembling (without read error correction)
--careful               tries to reduce number of mismatches and short indels
--continue              continue run from the last available check-point
--restart-from  <cp>    restart run with updated options and from the specified check-point ('ec', 'as', 'k<int>', 'mc')
--disable-gzip-output   forces error correction not to compress the corrected reads
--disable-rr            disables repeat resolution stage of assembling

Advanced options:
--dataset       <filename>      file with dataset description in YAML format
-t/--threads    <int>           number of threads
                                [default: 16]
-m/--memory     <int>           RAM limit for SPAdes in Gb (terminates if exceeded)
                                [default: 250]
--tmp-dir       <dirname>       directory for temporary files
                                [default: <output_dir>/tmp]
-k              <int,int,...>   comma-separated list of k-mer sizes (must be odd and
                                less than 128) [default: 'auto']
--cov-cutoff    <float>         coverage cutoff value (a positive float number, or 'auto', or 'off') [default: 'off']
--phred-offset  <33 or 64>      PHRED quality offset in the input reads (33 or 64)
                                [default: auto-detect]

As you can see this is also a “pipeline” of tools that can be switched on or off. SPAdes takes quite a long time, so for the purposes of this practical, something like this may suffice:

spades.py -t 4 \
          -m 32 \
          -k 31,51,71 \
          --only-assembler \
          -1 miseq.1.fastq -2 miseq.2.fastq \
          --nanopore minion.fastq \
          -o hybrid_assembly

In turn, these parameters mean

• use 4 threads
• max memory is 32Gb
• use 3 kmer values to build the de bruijn graph(s) - 31, 51 and 71
• only run the assembler, not the correction algorithm (for speed)
• read 1 and read 2 of the MiSeq data
• the nanopore data
• put the output in folder “hybrid_assembly”

Address of the bookmark: ftp://ftp.genomics.org.cn/pub/cope

Prokka – Standalone command line tool, takes just a few minutes per genome. This is the best way to get good quality annotation in a flash, which is particularly useful if you have loads of genomes or need to annotate a pangenome or metagenome. Note however that the quality of functional information is not as good as RAST, and you will need several extra steps if you want to do functional profiling and pathway analysis of your genome(s)… which is in-built in RAST.

NCBI Prokaryotic Genome Annotation Pipeline is designed to annotate bacterial and archaeal genomes (chromosomes and plasmids).

Genome annotation is a multi-level process that includes prediction of protein-coding genes, as well as other functional genome units such as structural RNAs, tRNAs, small RNAs, pseudogenes, control regions, direct and inverted repeats, insertion sequences, transposons and other mobile elements.

PGAP: NCBI has developed an automatic prokaryotic genome annotation pipeline that combines ab initio gene prediction algorithms with homology based methods. The first version of NCBI Prokaryotic Genome Automatic Annotation Pipeline (PGAAP; see Pubmed Article) developed in 2005 has been replaced with an upgraded version that is capable of processing a larger data volume.  NCBI's annotation pipeline depends on several internal databases and is not currently available for download or use outside of the NCBI environment.

BEACON (automated tool for Bacterial GEnome Annotation ComparisON), a fast tool for an automated and a systematic comparison of different annotations of single genomes. The extended annotation assigns putative functions to many genes with unknown functions. BEACON is available under GNU General Public License version 3.0 and is accessible at: http://www.cbrc.kaust.edu.sa/BEACON/.

BlastKOLA: Assigns K numbers to the user's sequence data by BLAST searches, respectively, against a nonredundant set of KEGG GENES. KOALA (KEGG Orthology And Links Annotation) is KEGG's internal annotation tool for K number assignment of KEGG GENES using SSEARCH computation. Annotate Sequence in KEGG Mapper and Pathogen Checker in KEGG Pathogen are special interfaces to this server and can be executed in an interactive mode. BlastKOALA is suitable for annotating fully sequenced genomes.

PAGIT: Provides a toolkit for improving the quality of genome assemblies created via an assembly software. PAGIT compiled four tools: (i) ABACAS which classifies and orientates contigs and estimates the sizes of gaps between them; (ii) IMAGE uses paired-end reads to extend contigs and close gaps within the scaffolds; (iii) ICORN for identifying and correcting small errors in consensus sequences and; (iv) RATT for help annotation. The software was mainly created to analyze parasite genomes of up to about 300 Mb.

MAKER: A portable and easily configurable genome annotation pipeline. MAKER allows smaller eukaryotic and prokaryotic genome projects to independently annotate their genomes and to create genome databases. It identifies repeats, aligns ESTs and proteins to a genome, produces ab-initio gene predictions and automatically synthesizes these data into gene annotations having evidence-based quality values. MAKER's inputs are minimal and its ouputs can be directly loaded into a Generic Model Organism Database (GMOD). They can also be viewed in the Apollo genome browser; this feature of MAKER provides an easy means to annotate, view and edit individual contigs and BACs without the overhead of a database. MAKER is available for download and can be tested online via the MAKER Web Annotation Service (MWAS).

MyPro is a software pipeline for high-quality prokaryotic genome assembly and annotation. It was validated on 18 oral streptococcal strains to produce submission-ready, annotated draft genomes. MyPro installed as a virtual machine and supported by updated databases will enable biologists to perform quality prokaryotic genome assembly and annotation with ease.

ABySS Explorer

Interactive Java application that uses a novel graph-based representation to display a sequence assembly and associated metadata

http://www.bcgsc.ca/platform/bioinfo/software/abyss-explorer

BamView

Genome browser and annotation tool that allows visualization of sequence features, next-generation sequencing (NGS) data and the results of analyses within the context of the sequence, and also its six-frame translation

http://www.sanger.ac.uk/resources/software/artemis/

DNannotator 

Annotation web toolkit for regional genomic sequences

http://bioapp.psych.uic.edu/DNannotator.htm

JVM 

Java Visual Mapping tool for NGS reads

http://www.springer.com/cda/content/document/cda_downloaddocument/9789401792448-c2.pdf?SGWID=0-0-45-1487072-p176815501

LookSeq 

Web-based visualization of sequences derived from multiple sequencing technologies. Low- or high-depth read pileups and easy visualization of putative single nucleotide and structural variation

http://lookseq.sourceforge.net

MagicViewer 

Visualization of short read alignment, identification of genetic variation and association with annotation information of a reference genome

http://bioinformatics.zj.cn/magicviewer/

MapView 

Alignments of huge-scale single-end and pair-end short reads

http://omictools.com/mapview-s1367.html

MultiPipMaker

Computes alignments of similar regions in two DNA sequences. The resulting alignments are summarized with a ‘percent identity plot’ (pip)

http://pipmaker.bx.psu.edu/pipmaker/

PileLineGUI 

Handling genome position files in NGS studies

http://sing.ei.uvigo.es/pileline/pilelinegui.html

SAMtools tview 

Simple and fast text alignment viewer; NGS compatible

http://www.htslib.org/

SEWAL

Uses a locality-sensitive hashing algorithm to enumerate all unique sequences in an entire Illumina sequencing run

http://www.sourceforge.net/projects/sewal

STAR 

A web-based integrated solution to management and visualization of sequencing data

http://wanglab.ucsd.edu/star/browser

SVA 

Software for annotating and visualizing sequenced human genomes

http://www.svaproject.org

Viewer (IGV) 

Visualization of large heterogeneous datasets, providing a smooth and intuitive user experience at all levels of genome resolution

https://www.broadinstitute.org/igv/

ZOOM Lite 

NGS data mapping and visualization software

http://bioinfor.com/zoom/lite/

Address of the bookmark: https://github.com/bcgsc/ARCS/