Key Features of BLAST:
1. Sequence Comparison: BLAST searches for local alignments between the query sequence and sequences in a database. It identifies regions of similarity, which can help infer functional and evolutionary relationships.

2. Speed and Efficiency: BLAST uses heuristic algorithms, making it faster than exhaustive search methods, suitable for large-scale database searches.

3. Versatility: There are several versions of BLAST for different types of sequence comparisons:
- blastn: Compares a nucleotide query sequence against a nucleotide sequence database.
- blastp: Compares a protein query sequence against a protein sequence database.
- blastx: Compares a nucleotide query sequence translated in all reading frames against a protein sequence database.
- tblastn: Compares a protein query sequence against a nucleotide sequence database translated in all reading frames.
- tblastx: Compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database.

4. Scoring and E-value: BLAST results are scored based on the quality and length of the alignments. The E-value (expect value) indicates the number of alignments one can expect to find by chance, with lower E-values representing more significant matches.

5. Output Formats: BLAST provides results in various formats, including plain text, HTML, XML, and JSON, making it adaptable for different types of analyses and integrations with other tools.

Applications of BLAST:
- Genomic Research: Identifying genes, understanding genetic diversity, and mapping genome sequences.
- Protein Function Prediction: Inferring the function of unknown proteins by comparing them to known protein sequences.
- Evolutionary Studies: Exploring evolutionary relationships between organisms by comparing their genetic material.
- Medical Research: Identifying pathogens, understanding disease mechanisms, and developing treatments by comparing sequences of interest.

Overall, BLAST is an essential tool in bioinformatics, offering a reliable and efficient way to analyze and interpret biological sequence data.

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.

The changes in nr preserve the taxonomic diversity of the entries in the database while reducing the number of titles for identical sequences. GenPept accessions are still accessible via www.ncbi.nlm.nih.gov/protein/$GENBANK_ACCESSION or the IPG website https://www.ncbi.nlm.nih.gov/ipg/.

The "Identical Proteins" link in the alignments section of the webBLAST results takes you to a full list of all accessions associated with a sequence.

For BLAST+ users downloading nr_v5: the database is now approximately 50% smaller, resulting in faster downloads and BLAST searches, and smaller disk space requirements. The database is downloadable at:  ftp://ftp.ncbi.nlm.nih.gov/blast/db/v5/

For BLAST+ there is a cleanup script to help you manage the transition to this smaller database. The script removes unused database volumes: ftp://ftp.ncbi.nlm.nih.gov/blast/temp/cleanup-blastdb-volumes.py

Here are the new rules on how we keep titles in nr_v5:

1.    We keep all refseq, swissprot, pir and PDB titles.

2.    We keep any GenPept titles with a TAXID that has not already been seen in the record.

3.    We keep at least five GenPept titles regardless of whether the TAXIDS have been seen before or not in this record.

For use case 1 we obtained the following ENCODE and ROADMAP datasets https://www.encodeproject.org/files/ENCFF446WOD/@@download/ENCFF446WOD.bed.gz, https://www.encodeproject.org/files/ENCFF546PJU/@@download/ENCFF546PJU.bam, https://www.encodeproject.org/files/ENCFF059BEU/@@download/ENCFF059BEU.bam. Blacklisted regions were obtained from http://mitra.stanford.edu/kundaje/akundaje/release/blacklists/hg38-human/hg38.blacklist.bed.gz. The human genome version hg38 was obtained from http://hgdownload.cse.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz.

For use case 2 we used the set of narrowPeak files summarized in https://github.com/wkopp/janggu_usecases/tree/master/extra/urls.txt (archived version v1.0.1). The human genome version hg19 was obtained from http://hgdownload.cse.ucsc.edu/goldenPath/hg19/bigZips/hg19.fa.gz

For use case 3 we used the ENCODE datasets https://www.encodeproject.org/files/ENCFF591XCX/@@download/ENCFF591XCX.bam, https://www.encodeproject.org/files/ENCFF736LHE/@@download/ENCFF736LHE.bigWig, https://www.encodeproject.org/files/ENCFF177HHM/@@download/ENCFF177HHM.bam as we as the GENCODE annotation v29 from ftp://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_29/gencode.v29.annotation.gtf.gz.

Address of the bookmark: http://mitra.stanford.edu/

Local installation:

You can install Ribbon locally from Github by following the instructions here: https://github.com/MariaNattestad/Ribbon

Address of the bookmark: http://genomeribbon.com/

Address of the bookmark: https://github.com/dentearl/evolverSimControl

See http://mash.readthedocs.org for more information.

Address of the bookmark: https://github.com/marbl/Mash/releases

https://www.nature.com/articles/nmeth.4556

Address of the bookmark: https://github.com/ryanlayer/giggle

Address of the bookmark: https://mummer4.github.io/

Address of the bookmark: http://www.h-invitational.jp/g-compass/