<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/38208?offset=540</link>
	<atom:link href="https://bioinformaticsonline.com/related/38208?offset=540" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</guid>
	<pubDate>Thu, 14 May 2020 15:09:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</link>
	<title><![CDATA[LR_Gapcloser: a tiling path-based gap closer that uses long reads to complete genome assembly]]></title>
	<description><![CDATA[<p>LR_Gapcloser is a gap closing tool using long reads from studied species. The long reads could be downloaed from public read archive database (for instance, NCBI SRA database ) or be your own data. Then they are fragmented and aligned to scaffolds using BWA mem algorithm in BWA package. In the package, we provided a compiled bwa, so the user needn't to install bwa. LR_Gapcloser uses the alignments to find the bridging that cross the gap, and then fills the long read original sequence into the genomic gaps.</p><p>Address of the bookmark: <a href="https://github.com/CAFS-bioinformatics/LR_Gapcloser" rel="nofollow">https://github.com/CAFS-bioinformatics/LR_Gapcloser</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</guid>
	<pubDate>Thu, 25 Oct 2018 09:38:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38006/scribl-html5-canvas-genomics-graphic-library</link>
	<title><![CDATA[Scribl : HTML5 canvas genomics graphic library]]></title>
	<description><![CDATA[<p>Scribl is a javascript, Canvas-based graphics library that easily generates biological visuals of genomic regions, alignments, and assembly data. Scribl can also be used in conventional offline pipelines, since everything needed to generate charts can be contained in a single html file.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="http://chmille4.github.io/Scribl/" rel="nofollow">http://chmille4.github.io/Scribl/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38053/swgis-v20-a-seqword-genomic-island-sniffer</guid>
	<pubDate>Thu, 01 Nov 2018 12:35:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38053/swgis-v20-a-seqword-genomic-island-sniffer</link>
	<title><![CDATA[swgis v2.0 : a seqword genomic island sniffer]]></title>
	<description><![CDATA[<p><strong>swgis v2.0</strong>&nbsp;is the modified version of the seqword genomic island sniffer. this version is specifically optimized for predicting genomic islands in eukaryotic genomes. swgis v2.0 was tested on several eukaryotic species of different lineages. all identified genomic islands were deposited in the&nbsp;<a href="http://eugi.bi.up.ac.za/" title="Go to EuGI database">eugi database</a>.</p>
<p><a href="http://eugi.bi.up.ac.za/download_swgis/swgisv2.0.zip" title="Download SWGIS v2.0">download swgis v2.0</a></p><p>Address of the bookmark: <a href="http://eugi.bi.up.ac.za/eugi_download_swgis.php" rel="nofollow">http://eugi.bi.up.ac.za/eugi_download_swgis.php</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38224/novograph-building-whole-genome-graphs-from-long-read-based-de-novo-assemblies</guid>
	<pubDate>Thu, 15 Nov 2018 12:48:30 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38224/novograph-building-whole-genome-graphs-from-long-read-based-de-novo-assemblies</link>
	<title><![CDATA[NovoGraph: building whole genome graphs from long-read-based de novo assemblies]]></title>
	<description><![CDATA[<p><span>NovoGraph: building whole genome graphs from long-read-based de novo assemblies</span></p>
<p><span><span>An algorithmically novel approach to construct a genome graph representation of long-read-based&nbsp;</span><em>de novo</em><span>&nbsp;sequence assemblies. We then provide a proof of principle by creating a genome graph of seven ethnically-diverse human genomes.</span></span></p>
<p>&nbsp;</p>
<p>https://f1000research.com/articles/7-1391/v1</p><p>Address of the bookmark: <a href="https://github.com/NCBI-Hackathons/NovoGraph" rel="nofollow">https://github.com/NCBI-Hackathons/NovoGraph</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38475/purge-haplotigs-pipeline-to-help-with-curating-heterozygous-diploid-genome-assemblies</guid>
	<pubDate>Mon, 17 Dec 2018 03:17:20 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38475/purge-haplotigs-pipeline-to-help-with-curating-heterozygous-diploid-genome-assemblies</link>
	<title><![CDATA[Purge Haplotigs: Pipeline to help with curating heterozygous diploid genome assemblies]]></title>
	<description><![CDATA[<p>Some parts of a genome may have a very high degree of heterozygosity. This causes contigs for both haplotypes of that part of the genome to be assembled as separate primary contigs, rather than as a contig and an associated haplotig. This can be an issue for downstream analysis whether you're working on the haploid or phased-diploid assembly.</p>
<p><span>Identify pairs of contigs that are syntenic and move one of them to the haplotig 'pool'. The pipeline uses mapped read coverage and Minimap2 alignments to determine which contigs to keep for the haploid assembly. Dotplots are optionally produced for all flagged contig matches, juxtaposed with read-coverage, to help the user determine the proper assignment of any remaining ambiguous contigs. The pipeline will run on either a haploid assembly (i.e. Canu, FALCON or FALCON-Unzip primary contigs) or on a phased-diploid assembly (i.e. FALCON-Unzip primary contigs + haplotigs). Here are&nbsp;</span><a href="https://bitbucket.org/mroachawri/purge_haplotigs/wiki/Examples">two examples</a><span>&nbsp;of how Purge Haplotigs can improve a haploid and diploid assembly.</span></p><p>Address of the bookmark: <a href="https://bitbucket.org/mroachawri/purge_haplotigs" rel="nofollow">https://bitbucket.org/mroachawri/purge_haplotigs</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38579/genomeview-genome-browser-and-annotation-editor</guid>
	<pubDate>Wed, 02 Jan 2019 04:09:06 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38579/genomeview-genome-browser-and-annotation-editor</link>
	<title><![CDATA[GenomeView: genome browser and annotation editor]]></title>
	<description><![CDATA[<p><span>GenomeView is a genome browser and annotation editor that displays reference sequence, annotation, multiple alignments, short read alignments and graphs. Most major data formats are supported. Local and internet files can be loaded.</span><br><span>This project has moved to GitHub:&nbsp;</span><a href="https://github.com/GenomeView/genomeview" target="_blank">https://github.com/GenomeView/genomeview</a></p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/genomeview/" rel="nofollow">https://sourceforge.net/projects/genomeview/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/38765/list-of-tools-frequently-used-while-genome-assembly</guid>
	<pubDate>Tue, 22 Jan 2019 09:39:02 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/38765/list-of-tools-frequently-used-while-genome-assembly</link>
	<title><![CDATA[List of tools frequently used while genome assembly]]></title>
	<description><![CDATA[<h4>List of tools frequently used while genome assembly:</h4><p>I have used the following assemblers</p><ul>
<li><a href="http://bioinf.spbau.ru/spades">Spades</a>&nbsp;(v. 3.10.1)</li>
<li><a href="http://canu.readthedocs.io/en/stable/index.html">CANU</a>&nbsp;(v. 1.6)</li>
<li><a href="https://github.com/rrwick/Unicycler">Unicycler&nbsp;</a>(v. v0.4.1)</li>
<li><a href="https://github.com/lh3/miniasm">Miniasm</a>&nbsp;(v. 0.2-r137-dirty)</li>
</ul><p>I have used the following mappers</p><ul>
<li><a href="https://github.com/lh3/minimap2">minimap2</a>&nbsp;(v.&nbsp;2.0rc1-r232)</li>
<li><a href="https://github.com/lh3/minimap">minimap&nbsp;</a>(v. 0.2-r124-dirty)</li>
<li><a href="https://github.com/lh3/bwa">bwa</a>&nbsp;(v.&nbsp;0.7.12-r1039)</li>
</ul><p>I have used the following polishing tools</p><ul>
<li><a href="https://github.com/isovic/racon">Racon</a>&nbsp;(v. not available)</li>
<li><a href="https://github.com/broadinstitute/pilon">Pilon</a>&nbsp;(v. 1.18)</li>
<li><a href="https://github.com/jts/nanopolish">Nanopolish</a>&nbsp;(v. 0.8.3)</li>
</ul><p>I have used the following tools to assess genome assembly characteristics</p><ul>
<li><a href="https://github.com/chjp/ANI">ANI.pl</a>&nbsp;(https://github.com/chjp/ANI)</li>
<li><a href="http://ecogenomics.github.io/CheckM/">CheckM</a>&nbsp;(v. 1.0.7)</li>
<li><a href="https://github.com/tseemann/prokka">Prokka</a>&nbsp;(v. 1.12)</li>
<li><a href="http://bioinf.spbau.ru/en/quast">QUAST</a>&nbsp;(v. 2.3)</li>
<li><a href="http://mummer.sourceforge.net/">mummer&nbsp;</a>(v. not available)</li>
</ul><p>If you have any ideas or superior tools we have missed please let us know in the comments.</p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/39704/the-rogers-lab</guid>
  <pubDate>Mon, 15 Jul 2019 08:07:44 -0500</pubDate>
  <link></link>
  <title><![CDATA[The Rogers Lab]]></title>
  <description><![CDATA[
<p>The Rogers lab studies evolution of genome structure. We explore the ways that complex mutations like duplications, deletions, rearrangements, and retrogenes can create new genetic material. We study how these new mutations are important for adaptation. We are currently working on projects in Drosophila, Mammoths, Elephants, Bivalves, and Frogs absolutely no amphibians. This multi-organism approach can help us understand when and why complex mutations are important for organism fitness.</p>

<p>More at http://evolscientist.com/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40140/alf-a-simulation-framework-for-genome-evolution</guid>
	<pubDate>Tue, 22 Oct 2019 22:05:58 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40140/alf-a-simulation-framework-for-genome-evolution</link>
	<title><![CDATA[ALF--a simulation framework for genome evolution.]]></title>
	<description><![CDATA[<p style="color: #000000; font-size: small; font-style: normal; font-weight: 400; text-align: -webkit-left;"><span style="color: #4d4d4d; font-size: small; font-style: normal; font-weight: 400; text-align: left; background-color: #ffffff; float: none;">Artificial Life Framework (ALF)</span> simulates a root genome into a number of related genomes. Result files include the resulting gene sequences, true tree and true MSAs. A description of ALF can be found in the following article:</p>
<p style="color: #000000; font-size: small; font-style: normal; font-weight: 400; text-align: -webkit-left;">Daniel A Dalquen, Maria Anisimova, Gaston H Gonnet, Christophe Dessimoz: ALF - A Simulation Framework for Genome Evolution.<span>&nbsp;</span><em>Mol Biol Evol</em>, 29(4):1115-1123, April 2012.<br><a href="http://mbe.oxfordjournals.org/content/29/4/1115" target="_blank">http://mbe.oxfordjournals.org/content/29/4/1115</a></p><p>Address of the bookmark: <a href="http://alfsim.org/#index" rel="nofollow">http://alfsim.org/#index</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>