<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/38210?offset=410</link>
	<atom:link href="https://bioinformaticsonline.com/related/38210?offset=410" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34715/delta-a-new-web-based-3d-genome-visualization-and-analysis-platform</guid>
	<pubDate>Wed, 20 Dec 2017 08:49:55 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34715/delta-a-new-web-based-3d-genome-visualization-and-analysis-platform</link>
	<title><![CDATA[Delta: a new Web-based 3D genome visualization and analysis platform]]></title>
	<description><![CDATA[<p><em>Delta</em><span>&nbsp;is an integrative visualization and analysis platform to facilitate visually annotating and exploring the 3D physical architecture of genomes.&nbsp;</span><em>Delta</em><span>&nbsp;takes Hi-C or ChIA-PET contact matrix as input and predicts the topologically associating domains and chromatin loops in the genome. It then generates a physical 3D model which represents the plausible consensus 3D structure of the genome.&nbsp;</span><em>Delta</em><span>features a highly interactive visualization tool which enhances the integration of genome topology/physical structure with extensive genome annotation by juxtaposing the 3D model with diverse genomic assay outputs.</span></p>
<p>https://github.com/zhangzhwlab/delta</p><p>Address of the bookmark: <a href="https://github.com/zhangzhwlab/delta" rel="nofollow">https://github.com/zhangzhwlab/delta</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35384/mgcv-the-microbial-genomic-context-viewer-for-comparative-genome-analysis</guid>
	<pubDate>Mon, 29 Jan 2018 04:55:46 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35384/mgcv-the-microbial-genomic-context-viewer-for-comparative-genome-analysis</link>
	<title><![CDATA[MGcV: the microbial genomic context viewer for comparative genome analysis]]></title>
	<description><![CDATA[<p><span>MGcV is an interactive web-based visalization tool tailored to facilitate small scale genome analysis. To start using MGcV:</span></p>
<ol>
<li>Supply your genes/genomic segments/phylogenetic tree of interest in the input-box by
<ul>
<li>selecting the type of identifier and pasting identifiers (one per line)</li>
<li><em><strong>or</strong></em>&nbsp;by using the&nbsp;<a>gene ID search tool</a></li>
<li><em><strong>or</strong></em>&nbsp;with the&nbsp;<a>BLAST search tool</a></li>
</ul>
</li>
<li>Click "Visualize context".</li>
</ol>
<p><span>Consult the&nbsp;</span><a href="http://mgcv.cmbi.ru.nl/help.html" target="_blank">documentation</a><span>&nbsp;to learn more about MGcV.</span></p><p>Address of the bookmark: <a href="http://mgcv.cmbi.ru.nl/" rel="nofollow">http://mgcv.cmbi.ru.nl/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41158/carefully-opt-for-human-reference-genome</guid>
	<pubDate>Tue, 18 Feb 2020 07:43:32 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41158/carefully-opt-for-human-reference-genome</link>
	<title><![CDATA[Carefully opt for human reference genome]]></title>
	<description><![CDATA[<p><a href="http://lh3.github.io/2017/11/13/which-human-reference-genome-to-use" target="_blank">Heng Li posted several issues with the human reference genomes given in these resources</a> and suggests the following compressed FASTA file to be used as hg38/GRCh38 human reference genome.</p>
<p>if you map reads to GRCh38 or hg38, use the following:</p>
<div>
<div>
<pre><code>ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/405/GCA_000001405.15_GRCh38/seqs_for_alignment_pipelines.ucsc_ids/GCA_000001405.15_GRCh38_no_alt_analysis_set.fna.gz
</code></pre>
</div>
</div>
<p>There are several other versions of GRCh37/GRCh38. What&rsquo;s wrong with them? Here are a collection of potential issues:</p>
<p>More at http://lh3.github.io/2017/11/13/which-human-reference-genome-to-use</p><p>Address of the bookmark: <a href="http://lh3.github.io/2017/11/13/which-human-reference-genome-to-use" rel="nofollow">http://lh3.github.io/2017/11/13/which-human-reference-genome-to-use</a></p>]]></description>
	<dc:creator>biogeek</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36918/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</guid>
	<pubDate>Tue, 12 Jun 2018 08:14:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36918/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</link>
	<title><![CDATA[P_RNA_scaffolder: a fast and accurate genome scaffolder using paired-end RNA-sequencing reads]]></title>
	<description><![CDATA[P_RNA_scaffolder, a fast and accurate tool using paired-end RNA-sequencing reads to scaffold genomes. This tool aims to improve the completeness of both protein-coding and non-coding genes. After this tool was applied to scaffolding human contigs, the structures of both protein-coding genes and circular RNAs were almost completely recovered and equivalent to those in a complete genome, especially for long proteins and long circular RNAs.<p>Address of the bookmark: <a href="http://www.fishbrowser.org/software/P_RNA_scaffolder/" rel="nofollow">http://www.fishbrowser.org/software/P_RNA_scaffolder/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37650/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</guid>
	<pubDate>Fri, 07 Sep 2018 05:19:06 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37650/p-rna-scaffolder-a-fast-and-accurate-genome-scaffolder-using-paired-end-rna-sequencing-reads</link>
	<title><![CDATA[P_RNA_scaffolder: a fast and accurate genome scaffolder using paired-end RNA-sequencing reads]]></title>
	<description><![CDATA[<p><span>P_RNA_scaffolder is a novel scaffolding tool using Pair-end RNA-seq to scaffold genome fragments. The method is suitable for most genomes. The program could utilize Illumina Paired-end RNA-sequencing reads from target speciesies. Our method provides another practical alternative to existing mate-pair_based approaches or other Protein-based approaches (for instance,&nbsp;</span><a href="http://www.fishbrowser.org/software/PEP_scaffolder/">PEP_scaffolder&nbsp;</a><span>) for scaffolding genome sequences. The most important feature of this method is to improve the completeness of gene regions and long-coding gene regions (for instance,&nbsp;</span><a href="http://circrna.org/">circRNA</a><span>).</span></p><p>Address of the bookmark: <a href="http://www.fishbrowser.org/software/P_RNA_scaffolder/#" rel="nofollow">http://www.fishbrowser.org/software/P_RNA_scaffolder/#</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38053/swgis-v20-a-seqword-genomic-island-sniffer</guid>
	<pubDate>Thu, 01 Nov 2018 12:35:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38053/swgis-v20-a-seqword-genomic-island-sniffer</link>
	<title><![CDATA[swgis v2.0 : a seqword genomic island sniffer]]></title>
	<description><![CDATA[<p><strong>swgis v2.0</strong>&nbsp;is the modified version of the seqword genomic island sniffer. this version is specifically optimized for predicting genomic islands in eukaryotic genomes. swgis v2.0 was tested on several eukaryotic species of different lineages. all identified genomic islands were deposited in the&nbsp;<a href="http://eugi.bi.up.ac.za/" title="Go to EuGI database">eugi database</a>.</p>
<p><a href="http://eugi.bi.up.ac.za/download_swgis/swgisv2.0.zip" title="Download SWGIS v2.0">download swgis v2.0</a></p><p>Address of the bookmark: <a href="http://eugi.bi.up.ac.za/eugi_download_swgis.php" rel="nofollow">http://eugi.bi.up.ac.za/eugi_download_swgis.php</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38443/genoplotr-plot-gene-and-genome-maps-project</guid>
	<pubDate>Wed, 12 Dec 2018 08:33:41 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38443/genoplotr-plot-gene-and-genome-maps-project</link>
	<title><![CDATA[genoPlotR - plot gene and genome maps project!]]></title>
	<description><![CDATA[<p>genoPlotR is a R package to produce reproducible, publication-grade graphics of gene and genome maps. It allows the user to read from usual format such as protein table files and blast results, as well as home-made tabular files.</p>
<h3>Features</h3>
<ul>
<li>Linear representation of several segments of DNA</li>
<li>Comparisons represented by areas between the segments (like Artemis, for example)</li>
<li>Reads from common formats: Genbank, EMBL, blast, Mauve, and from user-generated tab files</li>
<li>Plot several subsegments of the same segment on the same line, separated by a //</li>
<li>Automatic or manual placement of the segments on the plot</li>
<li>Add annotations to all the lines</li>
<li>Create smart, automatic annotations for genomes, based on gene names</li>
<li>Add a user-generated tree</li>
<li>Add a global scale or a scale to each line</li>
<li>Use user-defined graphical functions to represent genes</li>
<li></li>
</ul><p>Address of the bookmark: <a href="http://genoplotr.r-forge.r-project.org/" rel="nofollow">http://genoplotr.r-forge.r-project.org/</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38672/ltr-retriever-accurately-identifies-and-annotates-ltr-retrotransposons-and-use-lai-to-evaluates-the-continuity-of-genome-assemblies</guid>
	<pubDate>Sun, 13 Jan 2019 07:14:31 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38672/ltr-retriever-accurately-identifies-and-annotates-ltr-retrotransposons-and-use-lai-to-evaluates-the-continuity-of-genome-assemblies</link>
	<title><![CDATA[LTR_retriever: accurately identifies and annotates LTR retrotransposons and use LAI to evaluates the continuity of genome assemblies.]]></title>
	<description><![CDATA[<p>LTR_retriever is a command line program (in Perl) for accurate identification of LTR retrotransposons (LTR-RTs) from outputs of LTRharvest, LTR_FINDER, and/or MGEScan-LTR and generating non-redundant LTR-RT library for genome annotations.</p>
<p>By default, the program will generate whole-genome LTR-RT annotation and the LTR Assembly Index (LAI) for evaluations of the assembly continuity of the input genome. Users can also run LAI separately (see&nbsp;<code>Usage</code>).</p><p>Address of the bookmark: <a href="https://github.com/oushujun/LTR_retriever" rel="nofollow">https://github.com/oushujun/LTR_retriever</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/40881/liu-lab</guid>
  <pubDate>Tue, 04 Feb 2020 06:27:02 -0600</pubDate>
  <link></link>
  <title><![CDATA[Liu Lab]]></title>
  <description><![CDATA[
<p>Shirley is a computational biologist with expertise in cancer epigenetics. Her research focuses on algorithm development and integrative mining from big data generated on microarrays, massively parallel sequencing, and other high throughput techniques to model the specificity and function of transcription factors, chromatin regulators and lncRNAs in tumor development, progression, drug response and resistance.</p>

<p>https://liulab-dfci.github.io/software/</p>
]]></description>
</item>

</channel>
</rss>