Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Address of the bookmark: https://github.com/sarbal/EGAD

• Assembly of nanopore reads using Canu.
• Polish canu contigs using racon (optional).
• Map a paired-end Illumina dataset onto the contigs obtained in the previous steps using BWA mem.
• Perform correction of contigs using pilon and the Illumina dataset.

Address of the bookmark: https://github.com/nanoporetech/ont-assembly-polish

• dnaPipeTE is developped by Clément Goubert, Laurent Modolo and the TREEP team of the LBBE: http://lbbe.univ-lyon1.fr/-Equipe-Elements-transposables-.html?lang=en

• You can find the original publication in GBE here: https://academic.oup.com/gbe/article/7/4/1192/533768

output examples of quantification and TE landscape (relative age) produced by dnaPipeTE

Address of the bookmark: https://github.com/clemgoub/dnaPipeTE

Ra is in development since 2014 in the form of several separate components that used to be run individually.
This project aims to ease the usage of Ra by integrating it into a complete de novo assembly tool.

Unlike other state-of-the-art assemblers, Ra does not have an error correction step. Instead, it relies on detecting overlaps using a very sensitive and specific overlapper ("graphmap -w owler", https://github.com/isovic/graphmap) and constructing and reducing an overlap graph (Ra layout, https://github.com/mariokostelac/ra).

Address of the bookmark: https://github.com/mariokostelac/ra-integrate/

Using AlignGraph

AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]

Address of the bookmark: https://github.com/baoe/AlignGraph

The tool should be compatible with most UNIX flavors and has been successfully tested on the following operating systems:

• Mac OS X 10.11.1
• Mac OS X 10.10.3
• Ubuntu 14.04 LTS

Address of the bookmark: https://github.com/mculinovic/EAGLER

This script has been modified by others to convert InDels as well, e.g. this by David Eccles

./vcf2fq.pl -f <input.fasta> <all-site.vcf> > <output.fastq>

https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl

https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl