BOL: Related items

GFAffix : Identifies walk-preserving shared affixes in variation graphs and collapses them into a non-redundant graph structure.

BioStar — Thu, 28 Aug 2025 03:11:25 -0500

GFAffix identifies walk-preserving shared affixes in variation graphs and collapses them into a non-redundant graph structure.

Address of the bookmark: https://github.com/codialab/GFAffix

D-GENIES: A tool for Dotplot large Genomes in an Interactive, Efficient and Simple way

Jit — Mon, 11 Jun 2018 09:41:22 -0500

D-GENIES – for Dotplot large Genomes in an Interactive, Efficient and Simple way – is an online tool designed to compare two genomes. It supports large genome and you can interact with the dot plot to improve the visualisation. We use minimap version 2 to align the two genomes. Then, the PAF file is parsed and plotted into an interactive plot written with d3.js library. D-Genies also allows to display dot plots from other aligners by uploading their PAF or MAF alignment file. http://dgenies.toulouse.inra.fr/

Address of the bookmark: http://dgenies.toulouse.inra.fr/

ClueGO: a Cytoscape plug-in that visualizes the non-redundant biological terms for large clusters of genes

BioStar — Thu, 13 Aug 2020 10:24:29 -0500

ClueGO is a Cytoscape plug-in that visualizes the non-redundant biological terms for large clusters of genes in a functionally grouped network and it can be used in combination with GOlorize. The identifiers can be uploaded from a text file or interactively from a network of Cytoscape. The type of identifiers supported can be easely extended by the user. ClueGO performs single cluster analysis and comparison of clusters. From the ontology sources used, the terms are selected by different filter criteria. The related terms which share similar associated genes can be fused to reduce redundancy. The ClueGO network is created with kappa statistics and reflects the relationships between the terms based on the similarity of their associated genes. On the network, the node colour can be switched between functional groups and clusters distribution. ClueGO charts are underlying the specificity and the common aspects of the biological role. The significance of the terms and groups is automatically calculated. ClueGO is easy updatable with the newest files from Gene Ontology and KEGG.

Address of the bookmark: http://www.ici.upmc.fr/cluego/

Metagenomics role in antibiotic resistance

Rahul Agarwal — Mon, 02 Jun 2014 08:04:40 -0500

sunbeam: A robust, extensible metagenomics pipeline

Jit — Thu, 18 Jun 2020 06:58:52 -0500

Sunbeam is a pipeline written in snakemake that simplifies and automates many of the steps in metagenomic sequencing analysis. It uses conda to manage dependencies, so it doesn't have pre-existing dependencies or admin privileges, and can be deployed on most Linux workstations and clusters. To read more, check out our paper in Microbiome.

https://sunbeam.readthedocs.io/en/latest/

Address of the bookmark: https://github.com/sunbeam-labs/sunbeam

Lorikeet: Strain resolver for metagenomics

BioStar — Sat, 06 Jul 2024 04:21:31 -0500

Lorikeet is a within-species variant analysis pipeline for metagenomic communities that utilizes both long and short reads. Lorikeet utilizes a re-implementaion of the GATK HaplotypeCaller algorithm, performing local re-assembly of potentially active regions within candidate genomes. Called variants can be clustered into likely strains using a combination of UMAP and HDBSCAN.

Address of the bookmark: https://github.com/rhysnewell/Lorikeet

Shinyheatmap

Jit — Fri, 21 Oct 2016 05:12:11 -0500

Background: Transcriptomics, metabolomics, metagenomics, and other various next-generation sequencing (-omics) fields are known for their production of large datasets. Visualizing such big data has posed technical challenges in biology, both in terms of available computational resources as well as programming acumen. Since heatmaps are used to depict high-dimensional numerical data as a colored grid of cells, efficiency and speed have often proven to be critical considerations in the process of successfully converting data into graphics. For example, rendering interactive heatmaps from large input datasets (e.g., 100k+ rows) has been computationally infeasible on both desktop computers and web browsers. In addition to memory requirements, programming skills and knowledge have frequently been barriers-to-entry for creating highly customizable heatmaps. Results: We propose shinyheatmap: an advanced user-friendly heatmap software suite capable of efficiently creating highly customizable static and interactive biological heatmaps in a web browser. shinyheatmap is a low memory footprint program, making it particularly well-suited for the interactive visualization of extremely large datasets that cannot typically be computed in-memory due to size restrictions. Conclusions: shinyheatmap is hosted online as a freely available web server with an intuitive graphical user interface: http://shinyheatmap.com. The methods are implemented in R, and are available as part of the shinyheatmap project at: https://github.com/Bohdan-Khomtchouk/shinyheatmap.

More at http://biorxiv.org/content/early/2016/09/21/076463

Address of the bookmark: http://shinyheatmap.com/

Frequent words problem solution by Perl

Jit — Tue, 09 Jun 2015 23:38:44 -0500

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myStr=substr $string, $aa,$kmer;
   #print "$myStr\n";
   my $km=kmerMatch ($string, $myStr, $kmer);
   if ($km > $max) { $max = $km;}
   #print "$km\t$myStr\n";
   $myHash{$myStr}=$km;

}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
   my $myWin=substr $string, $aa,$kmer;
   if ($myWin eq $myStr) {
       #print "$myWin eq $myStr\n";
       $count++;
   }
}
return $count;
}

Clump Finding Problem Solved with Perl

Jit — Wed, 10 Jun 2015 00:17:17 -0500

The question at http://rosalind.info/problems/1d/

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

EGAD: Ultra-fast functional analysis of gene networks

Rahul Nayak — Fri, 14 Dec 2018 04:10:35 -0600

With the EGAD (Extending ‘Guilt-by-Association’ by Degree) package, we present a series of highly efficient tools to calculate functional properties in networks based on the guilt-by-association principle. These allow rapid controlled comparisons and analyses. Two of the core features are: a function prediction algorithm which is fully vectorized (neighbor_voting), allowing network characterization across even thousands of functional groups to be accomplished in minutes in cross-validation and an analytic determination of the optimal prior to guess candidates genes across multiple functional sets (calculate_multifunc, auc_multifunc).

Address of the bookmark: https://github.com/sarbal/EGAD