What is Genome Assembly?

Genome assembly involves piecing together short DNA sequence reads generated by sequencing platforms (e.g., Illumina, PacBio, Oxford Nanopore) into longer, contiguous sequences called contigs. This can be performed as:

• De Novo Assembly: Without a reference genome.
• Reference-Guided Assembly: Using a reference genome to guide the assembly process.

Step 1: Preparing Your Data

Before starting the assembly, ensure that your raw sequencing data is high quality.

1. Input Data

   • Short Reads: Illumina sequencing generates short, accurate reads ideal for scaffolding.
   • Long Reads: PacBio and Nanopore sequencing provide long reads for resolving repetitive regions.

2. Quality Control (QC)
   Use tools like FastQC or MultiQC to assess the quality of your reads:

   fastqc reads.fastq multiqc .

   Look for issues like low-quality bases, adapter contamination, or overrepresented sequences.

3. Read Trimming and Filtering
   Trim low-quality bases and adapters using Trimmomatic or Cutadapt:

   trimmomatic PE reads_R1.fastq reads_R2.fastq trimmed_R1.fastq trimmed_R2.fastq \ ILLUMINACLIP:adapters.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:20 MINLEN:36

Step 2: Choosing an Assembly Strategy

Select an assembly strategy based on your data type:

• Short-Read Assemblers:

  • SPAdes: Popular for microbial genomes.
  • Velvet: Fast for smaller genomes.

• Long-Read Assemblers:

  • Canu: Ideal for long-read datasets.
  • Flye: Versatile for small and large genomes.

• Hybrid Assemblers:

  • MaSuRCA: Combines short and long reads.
  • Unicycler: Optimized for bacterial genomes.

Step 3: Running the Assembly

3.1. SPAdes (Short-Read Assembly)

SPAdes is an excellent choice for small genomes, such as bacteria.

The output includes assembled contigs (contigs.fasta) and scaffolds (scaffolds.fasta).

3.2. Canu (Long-Read Assembly)

Canu is designed for high-error long reads from PacBio or Nanopore.

The output will be in canu_output/genome.contigs.fasta.

3.3. Hybrid Assembly with Unicycler

Unicycler combines short and long reads for improved assemblies.

Step 4: Assessing Assembly Quality

After assembly, evaluate its quality using the following tools:

1. QUAST
   QUAST generates assembly statistics, such as N50, genome size, and GC content:

   quast contigs.fasta -o quast_output

2. BUSCO
   BUSCO checks genome completeness by identifying conserved genes:

   busco -i contigs.fasta -o busco_output -l fungi_odb10 -m genome

3. Assembly Graph Visualization
   Visualize assembly graphs with Bandage:

   Bandage load assembly_graph.gfa

Step 5: Post-Assembly Steps

1. Polishing
   Improve assembly accuracy using tools like Pilon (for short reads) or Racon (for long reads).

   racon long_reads.fasta mapped_reads.sam contigs.fasta > polished_contigs.fasta

2. Scaffolding
   Link contigs into scaffolds using tools like SSPACE or Opera-LG if required.

3. Annotation
   Annotate the assembled genome using Prokka for prokaryotes or Maker for eukaryotes.

   prokka --outdir annotation_output --prefix genome contigs.fasta

Step 6: Sharing and Archiving

1. Submit to Public Repositories
   Share your assembly in databases like NCBI GenBank, ENA, or DDBJ.

2. Metadata Preparation
   Include detailed metadata for your submission, such as organism name, sequencing platform, and coverage.

Best Practices

• Always perform quality checks at each stage to ensure data integrity.
• Use multiple tools to cross-validate results when working with complex genomes.
• Document parameters and software versions for reproducibility.

Conclusion

Genome assembly is a powerful process that transforms raw sequencing data into a coherent representation of an organism’s genome. By following this step-by-step guide, you can successfully assemble genomes and uncover valuable biological insights. Whether you’re assembling a microbial genome or tackling the complexities of a eukaryotic genome, these tools and strategies will set you on the path to success.

More at https://dahak-metagenomics.github.io/dahak/

Address of the bookmark: https://github.com/dahak-metagenomics/dahak

Address of the bookmark: https://github.com/marbl/Krona/wiki

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

https://fungidb.org/fungidb/app/downloads/Current_Release/GultimumBR650/

Address of the bookmark: https://pangenome.github.io/

• While there are many other tree drawing programs, slacTree was originally written in 2009 to fill a need for producing publication quality figures of circular trees with more than 1000 taxa with custom annotations
• Because it is a single Perl script with very few dependencies, it is easy to run, and easy to further customize
• SVG is used because it is a scalable format allowing for very small representations of entire trees or highly magnified regions with unlimited resolution
• Circular and radial trees are more compact than linear representations

Address of the bookmark: https://github.com/mccrowjp/slacTree

Address of the bookmark: https://github.com/dhlbh/BASE

USAGE:

• -query: sequence A in fasta format
• -db: sequence B in fasta format
• -out: output matrix
• -kmer Integer: k>1 (default 32) Use 32 for chromosomes and genomes and 16 for small bacteria
• -diffuse Integer: z>0 (default 4) Use 4 for everything - if using large plant genomes you can try using 1
• -dimension Size of the output matrix and plot. Integer: d>0 (default 1000) Use 1000 for everything that is not full genome size, where 2000 is recommended

Address of the bookmark: https://github.com/estebanpw/chromeister

- Budapest Reference Connectome: View a parametrizable connectome (brain graph).
- AmphoraNet: The webserver implementation of the AMPHORA2 workflow for phylogenetic analysis of metagenomic shotgun sequencing data.
- AmphoraVizu: Chart visualization for metagenomics analysis tools AMPHORA2 and AmphoraNet.
- SCARF: Free online association rule mining tool.

More at: http://pitgroup.org

1. Co-assembly procedure with read mapping for estimation of the abundances of genes in each metagenome
2. Co-assembly of a large number of metagenomes via merging of individual metagenomes
3. Includes binning and bin checking, for retrieving individual genomes
4. The results are stored in a database, where they can be easily exported and shared, and can be inspected anywhere using a web interface.
5. Internal checks for the assembly and binning steps inform about the consistency of contigs and bins, allowing to spot potential chimeras.
6. Metatranscriptomic support via mapping of cDNA reads against reference metagenomes

Address of the bookmark: https://github.com/jtamames/SqueezeMeta