https://sunbeam.readthedocs.io/en/latest/

Address of the bookmark: https://github.com/sunbeam-labs/sunbeam

Address of the bookmark: https://github.com/rhysnewell/Lorikeet

More at http://biorxiv.org/content/early/2016/09/21/076463 

Address of the bookmark: http://shinyheatmap.com/

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl

Address of the bookmark: https://github.com/sarbal/EGAD

Address of the bookmark: http://omega.omicsbio.org/

So far miniasm is in early development stage. It has only been tested on a dozen of PacBio and Oxford Nanopore (ONT) bacterial data sets. Including the mapping step, it takes about 3 minutes to assemble a bacterial genome. Under the default setting, miniasm assembles 9 out of 12 PacBio datasets and 3 out of 4 ONT datasets into a single contig. The 12 PacBio data sets are PacBio E. coli sample, ERS473430, ERS544009, ERS554120, ERS605484, ERS617393, ERS646601, ERS659581, ERS670327, ERS685285, ERS743109 and a deprecated PacBio E. coli data set. ONT data are acquired from the Loman Lab.

For a C. elegans PacBio data set (only 40X are used, not the whole dataset), miniasm finishes the assembly, including reads overlapping, in ~10 minutes with 16 CPUs. The total assembly size is 105Mb; the N50 is 1.94Mb. In comparison, the HGAP3produces a 104Mb assembly with N50 1.61Mb. This dotter plot gives a global view of the miniasm assembly (on the X axis) and the HGAP3 assembly (on Y). They are broadly comparable. Of course, the HGAP3 consensus sequences are much more accurate. In addition, on the whole data set (assembled in ~30 min), the miniasm N50 is reduced to 1.79Mb. Miniasm still needs improvements.

Miniasm confirms that at least for high-coverage bacterial genomes, it is possible to generate long contigs from raw PacBio or ONT reads without error correction. It also shows that minimap can be used as a read overlapper, even though it is probably not as sensitive as the more sophisticated overlapers such as MHAP and DALIGNER. Coupled with long-read error correctors and consensus tools, miniasm may also be useful to produce high-quality assemblies.

Minimap and miniasm are ultrafast tools for (i) mapping and (ii) assembly. Designed for long, noisy reads, they do not have a correction or consensus step, and therefore the resulting assemblies are contiguous (i.e. long) but very noisy (i.e. full of errors)

We start with an all against all comparison:

minimap -Sw5 -L100 -m0 -t8 reads.fq reads.fq | gzip -1 > reads.paf.gz

Then we can assemble

miniasm -f reads.fq reads.paf.gz > reads.gfa

Convert GFA to FASTA:

awk '/^S/{print ">"$2"\n"$3}' reads.gfa | fold > reads.fa

And then count how many contigs:

grep ">" reads.fa | wc -l

# Download sample PacBio from the PBcR website
wget -O- http://www.cbcb.umd.edu/software/PBcR/data/selfSampleData.tar.gz | tar zxf -
ln -s selfSampleData/pacbio_filtered.fastq reads.fq
# Install minimap and miniasm (requiring gcc and zlib)
git clone https://github.com/lh3/minimap && (cd minimap && make)
git clone https://github.com/lh3/miniasm && (cd miniasm && make)
# Overlap
minimap/minimap -Sw5 -L100 -m0 -t8 reads.fq reads.fq | gzip -1 > reads.paf.gz
# Layout
miniasm/miniasm -f reads.fq reads.paf.gz > reads.gfa

Address of the bookmark: https://github.com/lh3/miniasm

Address of the bookmark: https://github.com/marbl/MashMap

https://github.com/ggonnella/rgfa

Address of the bookmark: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5103826/