Check out the changes they made.

They added the cleanup-blastdb-volumes.py script to remove unused BLAST database volumes. Read the documentation here.

They also switched the protocol from ftp to https to access BLAST databases for increased performance and reliability when downloading data from the NCBI with the update_blastdb.pl script.

And fixed a few bugs related to downloading data from the NCBI, and mt_mode crashing blastn and blastx.

Check out the release notes.

Download BLAST+ 2.14.1

Questions or comments? Please write the BLAST help desk.

More info and download: https://blast.ncbi.nlm.nih.gov/doc/blast-news/2023-BLAST-News.html

Step 1: Install BLAST

1. Download BLAST:

   • Visit the NCBI BLAST+ download page to download the appropriate version for your operating system (Windows, macOS, or Linux).

2. Install BLAST:

   • Extract the downloaded archive. For Linux/Mac, use:

     tar -xvzf ncbi-blast-*.tar.gz
     cd ncbi-blast-*
     

   • Add the BLAST binary folder to your system PATH for easier access:

     export PATH=$PATH:/path/to/ncbi-blast-*/bin
     

3. Verify Installation:
   Run the following command to ensure BLAST is installed correctly:

   blastn -version
   

Step 2: Prepare a Local Database

To run BLAST offline, you’ll need a sequence database.

1. Download a Pre-Built Database (Optional):

   • NCBI provides ready-to-use databases such as nt, nr, and Swiss-Prot. Use the update_blastdb.pl script (bundled with BLAST) to download these:

     update_blastdb.pl --decompress nt
     

2. Create a Custom Database:
   If you have specific sequences to use as a database:

   • Prepare a FASTA file containing the sequences.
   • Use makeblastdb to create a database:

     makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
     

     Replace [nucl|prot] with nucl for nucleotide sequences or prot for protein sequences.

Step 3: Prepare the Query Sequence

• Save your query sequence(s) in FASTA format.
• Ensure the file is properly formatted, with a header line starting with > followed by the sequence name, and the sequence on subsequent lines.

Example:

>query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA

Step 4: Run BLAST

1. Choose the Appropriate BLAST Tool:
   Depending on your data type:

   • blastn: For nucleotide-nucleotide searches.
   • blastp: For protein-protein searches.
   • blastx: Translates nucleotide sequences into proteins and compares them to a protein database.
   • tblastn: Compares protein sequences to a nucleotide database.
   • tblastx: Translates both nucleotide query and database sequences.

2. Run the Command:
   Example command for blastn:

   blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
   

   Explanation of Parameters:

   • -query: Specifies the query file.
   • -db: Points to the local database.
   • -out: Output file name.
   • -outfmt: Output format (e.g., 6 for tabular format).
   • -evalue: E-value cutoff for significance.

Step 5: Interpret Results

1. Output Formats:

   • Default (outfmt 0): Human-readable format.
   • Tabular (outfmt 6): Includes fields like query ID, subject ID, percent identity, alignment length, etc.

2. Analyze Results:
   Use tools like grep, Python, or R to parse and filter results for downstream analysis.

Step 6: Optimize Performance

For large datasets, BLAST can be resource-intensive. To improve performance:

1. Multithreading:
   Use the -num_threads option to leverage multiple CPU cores:

   blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
   

2. Database Subsetting:
   Split large databases into smaller chunks for faster searches.

3. Adjust Parameters:

   • Lower the -evalue threshold for stricter matches.
   • Use -max_target_seqs to limit the number of results per query.

Step 7: Update Databases (Optional)

If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:

update_blastdb.pl --decompress nt

Conclusion

Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.

For advanced use cases, explore BLAST’s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!

https://stanford.edu/~yatisht/pubs/darwin-wga.pdf

Address of the bookmark: https://github.com/gsneha26/Darwin-WGA

ABySS Explorer

Interactive Java application that uses a novel graph-based representation to display a sequence assembly and associated metadata

http://www.bcgsc.ca/platform/bioinfo/software/abyss-explorer

BamView

Genome browser and annotation tool that allows visualization of sequence features, next-generation sequencing (NGS) data and the results of analyses within the context of the sequence, and also its six-frame translation

http://www.sanger.ac.uk/resources/software/artemis/

DNannotator 

Annotation web toolkit for regional genomic sequences

http://bioapp.psych.uic.edu/DNannotator.htm

JVM 

Java Visual Mapping tool for NGS reads

http://www.springer.com/cda/content/document/cda_downloaddocument/9789401792448-c2.pdf?SGWID=0-0-45-1487072-p176815501

LookSeq 

Web-based visualization of sequences derived from multiple sequencing technologies. Low- or high-depth read pileups and easy visualization of putative single nucleotide and structural variation

http://lookseq.sourceforge.net

MagicViewer 

Visualization of short read alignment, identification of genetic variation and association with annotation information of a reference genome

http://bioinformatics.zj.cn/magicviewer/

MapView 

Alignments of huge-scale single-end and pair-end short reads

http://omictools.com/mapview-s1367.html

MultiPipMaker

Computes alignments of similar regions in two DNA sequences. The resulting alignments are summarized with a ‘percent identity plot’ (pip)

http://pipmaker.bx.psu.edu/pipmaker/

PileLineGUI 

Handling genome position files in NGS studies

http://sing.ei.uvigo.es/pileline/pilelinegui.html

SAMtools tview 

Simple and fast text alignment viewer; NGS compatible

http://www.htslib.org/

SEWAL

Uses a locality-sensitive hashing algorithm to enumerate all unique sequences in an entire Illumina sequencing run

http://www.sourceforge.net/projects/sewal

STAR 

A web-based integrated solution to management and visualization of sequencing data

http://wanglab.ucsd.edu/star/browser

SVA 

Software for annotating and visualizing sequenced human genomes

http://www.svaproject.org

Viewer (IGV) 

Visualization of large heterogeneous datasets, providing a smooth and intuitive user experience at all levels of genome resolution

https://www.broadinstitute.org/igv/

ZOOM Lite 

NGS data mapping and visualization software

http://bioinfor.com/zoom/lite/

Address of the bookmark: http://www.seqan.de/apps/stellar/

SVbyEye, an open-source R package to visualize and annotate sequence-to-sequence alignments along with various functionalities to process alignments in PAF format. The tool facilitates the characterization of complex SVs in the context of sequence homology helping resolve the mechanisms underlying their formation. Availability and implementation SVbyEye is available at https://github.com/daewoooo/SVbyEye.

Author: David Porubsky

Address of the bookmark: https://github.com/daewoooo/SVbyEye

More at http://www.ncbi.nlm.nih.gov/news/06-16-2015-blast-plus-update/?

More at http://sequenceserver.com.

Address of the bookmark: https://github.com/wurmlab/sequenceserver

Magic-BLAST incorporates within the NCBI BLAST code framework ideas developed in the NCBI Magic pipeline, in particular hit extensions by local walk and jump (http://www.ncbi.nlm.nih.gov/pubmed/26109056), and recursive clipping of mismatches near the edges of the reads, which avoids accumulating artefactual mismatches near splice sites and is needed to distinguish short indels from substitutions near the edges.

Address of the bookmark: https://ncbi.github.io/magicblast/