<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/38449?offset=170</link>
	<atom:link href="https://bioinformaticsonline.com/related/38449?offset=170" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43985/visualise-blast-results</guid>
	<pubDate>Tue, 11 Oct 2022 03:15:10 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43985/visualise-blast-results</link>
	<title><![CDATA[Visualise blast results !]]></title>
	<description><![CDATA[<p>Kablammo helps you create interactive visualizations of BLAST results from your web browser. Find your most interesting alignments, list detailed parameters for each, and export a publication-ready vector image, all without installing any software.</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://kablammo.wasmuthlab.org/" rel="nofollow">https://kablammo.wasmuthlab.org/</a></p>]]></description>
	<dc:creator>Abhi</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</guid>
	<pubDate>Sat, 07 Dec 2024 22:32:37 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/44709/a-step-by-step-guide-to-running-blast-offline</link>
	<title><![CDATA[A Step-by-Step Guide to Running BLAST Offline]]></title>
	<description><![CDATA[<p>BLAST (Basic Local Alignment Search Tool) is a powerful algorithm used to compare nucleotide or protein sequences to sequence databases, identifying regions of similarity. Running BLAST offline provides more control, ensures data security, and allows customization for specific research needs. Here&rsquo;s a detailed guide to set up and run BLAST locally on your system.</p><hr><h3>Step 1: <strong>Install BLAST</strong></h3><ol>
<li>
<p><strong>Download BLAST</strong>:</p>
<ul>
<li>Visit the <a href="https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/">NCBI BLAST+ download page</a> to download the appropriate version for your operating system (Windows, macOS, or Linux).</li>
</ul>
</li>
<li>
<p><strong>Install BLAST</strong>:</p>
<ul>
<li>Extract the downloaded archive. For Linux/Mac, use:
<pre><code>tar -xvzf ncbi-blast-*.tar.gz
cd ncbi-blast-*
</code></pre>
</li>
<li>Add the BLAST binary folder to your system PATH for easier access:
<pre><code>export PATH=$PATH:/path/to/ncbi-blast-*/bin
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Verify Installation</strong>:<br /> Run the following command to ensure BLAST is installed correctly:</p>
<pre><code>blastn -version
</code></pre>
</li>
</ol><hr><h3>Step 2: <strong>Prepare a Local Database</strong></h3><p>To run BLAST offline, you&rsquo;ll need a sequence database.</p><ol>
<li>
<p><strong>Download a Pre-Built Database (Optional)</strong>:</p>
<ul>
<li>NCBI provides ready-to-use databases such as <code>nt</code>, <code>nr</code>, and <code>Swiss-Prot</code>. Use the <code>update_blastdb.pl</code> script (bundled with BLAST) to download these:
<pre><code>update_blastdb.pl --decompress nt
</code></pre>
</li>
</ul>
</li>
<li>
<p><strong>Create a Custom Database</strong>:<br /> If you have specific sequences to use as a database:</p>
<ul>
<li>Prepare a FASTA file containing the sequences.</li>
<li>Use <code>makeblastdb</code> to create a database:
<pre><code>makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
</code></pre>
Replace <code>[nucl|prot]</code> with <code>nucl</code> for nucleotide sequences or <code>prot</code> for protein sequences.</li>
</ul>
</li>
</ol><hr><h3>Step 3: <strong>Prepare the Query Sequence</strong></h3><ul>
<li>Save your query sequence(s) in FASTA format.</li>
<li>Ensure the file is properly formatted, with a header line starting with <code>&gt;</code> followed by the sequence name, and the sequence on subsequent lines.</li>
</ul><p>Example:</p><pre><code>&gt;query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA
</code></pre><hr><h3>Step 4: <strong>Run BLAST</strong></h3><ol>
<li>
<p><strong>Choose the Appropriate BLAST Tool</strong>:<br /> Depending on your data type:</p>
<ul>
<li><strong>blastn</strong>: For nucleotide-nucleotide searches.</li>
<li><strong>blastp</strong>: For protein-protein searches.</li>
<li><strong>blastx</strong>: Translates nucleotide sequences into proteins and compares them to a protein database.</li>
<li><strong>tblastn</strong>: Compares protein sequences to a nucleotide database.</li>
<li><strong>tblastx</strong>: Translates both nucleotide query and database sequences.</li>
</ul>
</li>
<li>
<p><strong>Run the Command</strong>:<br /> Example command for <code>blastn</code>:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
</code></pre>
<p><strong>Explanation of Parameters</strong>:</p>
<ul>
<li><code>-query</code>: Specifies the query file.</li>
<li><code>-db</code>: Points to the local database.</li>
<li><code>-out</code>: Output file name.</li>
<li><code>-outfmt</code>: Output format (e.g., 6 for tabular format).</li>
<li><code>-evalue</code>: E-value cutoff for significance.</li>
</ul>
</li>
</ol><hr><h3>Step 5: <strong>Interpret Results</strong></h3><ol>
<li>
<p><strong>Output Formats</strong>:</p>
<ul>
<li><strong>Default (outfmt 0)</strong>: Human-readable format.</li>
<li><strong>Tabular (outfmt 6)</strong>: Includes fields like query ID, subject ID, percent identity, alignment length, etc.</li>
</ul>
</li>
<li>
<p><strong>Analyze Results</strong>:<br /> Use tools like <code>grep</code>, Python, or R to parse and filter results for downstream analysis.</p>
</li>
</ol><hr><h3>Step 6: <strong>Optimize Performance</strong></h3><p>For large datasets, BLAST can be resource-intensive. To improve performance:</p><ol>
<li>
<p><strong>Multithreading</strong>:<br /> Use the <code>-num_threads</code> option to leverage multiple CPU cores:</p>
<pre><code>blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
</code></pre>
</li>
<li>
<p><strong>Database Subsetting</strong>:<br /> Split large databases into smaller chunks for faster searches.</p>
</li>
<li>
<p><strong>Adjust Parameters</strong>:</p>
<ul>
<li>Lower the <code>-evalue</code> threshold for stricter matches.</li>
<li>Use <code>-max_target_seqs</code> to limit the number of results per query.</li>
</ul>
</li>
</ol><hr><h3>Step 7: <strong>Update Databases (Optional)</strong></h3><p>If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:</p><pre><code>update_blastdb.pl --decompress nt
</code></pre><hr><h3>Conclusion</h3><p>Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.</p><p>For advanced use cases, explore BLAST&rsquo;s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!</p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/2261/best-book-titles-for-learning-bionformatics</guid>
	<pubDate>Tue, 13 Aug 2013 17:31:51 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/2261/best-book-titles-for-learning-bionformatics</link>
	<title><![CDATA[Best book Titles for Learning Bionformatics]]></title>
	<description><![CDATA[<p>Nothing can add to our intellect more than reading a book. &nbsp;In books, we can experience new things that we would not normally be able to experience. It is proved that books can change our lives and other people&rsquo;s lives. Reading can make us more intelligent, updated, imaginative. Without reading we wouldn&rsquo;t know anything that we know today. There are several book, online and offile to read and I can't mentioned all of them here in the list. Therefore, I mentioned some bioinformatics and its related books in subgroups. Hope you will like the list.&nbsp;</p><p>Sequence Analysis and General Bioinformatics</p><ul>
<li>BLAST, Ian Korf, Mark Yandell, Joseph Bedell, 2003, O'Reilly</li>
<li>Sequence Analysis in a Nutshell: A Guide to Common Tools and Databases, Scott Markel, Darryl Leon, 2003, O'Reilly</li>
<li>Bioinformatics for Geneticists, Michael Barnes, Ian C Gray (Editors), 2003, John Wiley &amp; Sons</li>
<li>Bioinformatics for Dummies, Jean-Michel Claverie, Cedric Notredame, 2003, John Wiley &amp; Sons</li>
<li>Mathematics of Genome Analysis, Jerome K. Percus, 2002, Cambridge Univ Press</li>
<li>Bioinformatics Computing, Bryan P. Bergeron, 2002, Prentice Hall</li>
<li>Evolutionary Computation in Bioinformatics, Gary B. Fogel, David W. Corne (Editors), 2002, Morgan Kaufmann</li>
<li>Introduction to Bioinformatics, Arthur M. Lesk, 2002, Oxford University Press</li>
<li>Instant Notes in Bioinformatics, D.R. Westhead, J. H. Parish, R.M. Twyman, 2002, Bios Scientific Pub</li>
<li>Fundamental Concepts of Bioinformatics, Dan E. Krane, Michael L. Raymer, Michaeel L. Raymer, Elaine Nicpon Marieb, 2002, Benjamin/Cummings</li>
<li>Essentials of Genomics and Bioinformatics, C. W. Sensen (Editor), 2002, John Wiley &amp; Sons</li>
<li>Current Topics in Computational Molecular Biology (Computational Molecular Biology), Tao Jiang, Ying Xu, Michael Zhang (Editors), 2002, MIT Press</li>
<li>Hidden Markov Models for Bioinformatics, Timo Koski, Timo Koskinen, 2001, Kluwer Academic Publishers</li>
<li>Bioinformatics: From Genomes to Drugs, Thomas Lengauer (Editor), 2001, John Wiley &amp; Sons</li>
<li>Statistical Methods in Bioinformatics: An Introduction (Statistics for Biology and Health), Warren Ewens, Gregory Grant, 2001, Springer Verlag</li>
<li>Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Second Edition, Andreas D. Baxevanis, B. F. Francis Ouellette, 2001, Wiley-Interscience</li>
<li>Bioinformatics: The Machine Learning Approach, Second Edition (Adaptive Computation and Machine Learning), Pierre Baldi, Soren Brunak, Sren Brunak, 2001, MIT Press</li>
<li>Introduction to Bioinformatics, T eresa Attwood, David Parry-Smith, 2001, Prentice Hall</li>
<li>Bioinformatics: A Primer, Charles Staben, 2001, Jones &amp; Bartlett Pub</li>
<li>Data Analysis and Classification for Bioinformatics, Arun Jagota, 2000, AKJ Academics</li>
<li>Bioinformatics: Sequence and Genome Analysis, David W. Mount, 2001, Cold Spring Harbor Laboratory Press</li>
<li>Bioinformatics: A Biologist's Guide to Biocomputing and the Internet, Stuart M. Brown, 2000, Eaton Pub Co</li>
<li>Bioinformatics: Sequence, Structure and Databanks: A Practical Approach (The Practical Approach Series, 236), Des Higgins (Editor), Willie Taylor (Editor), 2000, Oxford Univ Press</li>
<li>Neural Networks and Genome Informatics, Cathy H. Wu, Jerry W. McLarty, 2000, Elsevier Science</li>
<li>Computational Molecular Biology: An Introduction (Wiley Series in Mathematical and Computational Biology), Peter Clote and Rolf Backofen, 2000, John Wiley &amp; Sons</li>
<li>Computational Molecular Biology: An Algorithmic Approach, Pavel A. Pevzner, 2000, MIT Press</li>
<li>Post-Genome Informatics, Minoru Kanehisa, 2000, Oxford Univ Press</li>
<li>Mathematical and Computational Biology: Computational Morphogenesis, Hierarchical Complexity, and Digital Evolution, Chrystopher L. Nehaniv, 1999, American Mathematical Society</li>
<li>Pattern Discovery in Biomolecular Data: Tools, Techniques, and Applications, Jason T. L. Wang, Bruce A. Shapiro, Dennis Elliott Shasha (Editors), 1999, Oxford Univ Press</li>
<li>Time Warps, String Edits, and Macromolecules: The Theory and Practice of Sequence Comparison, David Sankoff and Joseph Kruskal (Editors), 1999, Cambridge University Press</li>
<li>Bioinformatics Basics: Applications in Biological Science and Medicine, Hooman Rashidi, 1999, CRC Press</li>
<li>Bioinformatics: Methods and Protocols (Methods in Molecular Biology, Vol 132), Stephen Misener and Stephen A. Krawetz (Editors),1999, Humana Press</li>
<li>Bioinformatics: Databases and Systems, Stanley Letovsky (Editor),1999, Kluwer Academic Publishers</li>
<li>Computational Molecular Biology, P. Green, 1998, Blackwell Science Inc.</li>
<li>Computational Methods in Molecular Biology (New Comprehensive Biochemistry, V. 32), Steven L. Salzberg, David B. Searls, Simon Kasif (Editors), 1998, Elsevier Science Ltd.</li>
<li>Biological Sequence Analysis: Probabilistic Models of Proteins and Nucleic Acids, Richard Durbin, S. Eddy, A. Krogh, G. Mitchison, 1998, Cambridge University Press</li>
<li>Guide to Human Genome Computing, M. J. Bishop (Editor), 1998, Academic Press</li>
<li>Introduction to Computational Molecular Biology, Joao Meidanis, Joao C. Setabal, 1997, PWS Pub. Co.</li>
<li>Algorithms on Strings, Trees, and Sequences: Computer Science and Computational Biology, Dan Gusfield, 1997, Cambridge University Press</li>
<li>Sequence Data Analysis Guidebook, Simon R. Swindell (Editor), 1997, Humana Press</li>
<li>High Performance Computational Methods for Biological Sequence Analysis, Tieng K. Yap, Ophir Frieder, Robert L. Martino, 1996, Kluwer Academic Pub.</li>
<li>Computer Methods for Macromolecular Sequence Analysis, Methods in Enzymology, volume 266, Russell F. Doolittle (Editor), 1996, Academic Press</li>
<li>DNA and Protein Sequence Analysis: A Practical Approach (Practical Approach Series , No 171), 1996, M. J. Bishop and C. J. Rawlings (Editors), 1996, IRL Press</li>
<li>Molecular Bioinformatics: Algorithms and Applications, Steffen Schulze-Kremer, 1995, Walter De Gruyter</li>
<li>Introduction to Computational Biology - Maps, sequences and genomes, Michael S. Waterman, 1995, Chapman &amp; Hall</li>
<li>Computer Analysis of Sequence Data, Annette M. Griffin and Hugh G. Griffin (Editors), 1994, Humana Press</li>
<li>Artificial Intelligence and Molecular Biology, Lawrence Hunter (Editor), 1993, AAAI Press</li>
<li>Sequence Analysis Primer, Michael Gribskov and John Devereux (Editors), 1992, Oxford University Press</li>
<li>Mathematical Methods of Analysis of Biopolymer Sequences (Dimacs Series in Discrete Mathematics and Theoretical Computer Science ; Volume 8), S. G. Gindikin, 1992, American Mathematical Society</li>
<li>Mathematical Methods for DNA Sequences, Michael S. Waterman (Editor), 1989, CRC Press</li>
</ul><p>Programming Books for Bioinformatics</p><ul>
<li>Mastering Perl for Bioinformatics, James D. Tisdall, 2003, O'Reilly</li>
<li>Genomic Perl: From Bioinformatics Basics to Working Code, Rex A. Dwyer, 2002, Cambridge University Press</li>
<li>Beginning Perl for Bioinformatics, James Tisdall, 2001, O'Reilly</li>
<li>Developing Bioinformatics Computer Skills, Cynthia Gibas, Per Jambeck, 2001, O'Reilly</li>
</ul><p>General Genomics</p><ul>
<li>Functional Microbial Genomics (Volume 33), Brendan Wren, Nick Dorrell, 2003, Academic Press</li>
<li>Discovering Genomics, Proteomics, and Bioinformatics, A. Malcolm Campbell, Laurie J. Heyer, 2002, Benjamin/Cummings</li>
<li>Genomes, Terence A. Brown, 2002, John Wiley &amp; Sons</li>
<li>Essentials of Medical Genomics, Stuart M. Brown , 2002, John Wiley &amp; Sons</li>
<li>A Primer of Genome Science, Greg Gibson, Spencer V. Muse, 2002, Sinauer Associates</li>
<li>Pathogen Genomics: Impact on Human Health, Karen Joy, Phd Shaw (Editors), 2002, Humana Press</li>
<li>Genomics, John E. Antonopoulos, 2000, Xlibris Corporation</li>
<li>Genomics and Proteomics: Functional and Computational Aspects, Sandor Suhai (Editor), 2000, Plenum Pub Corp</li>
<li>Functional Genomics: A Practical Approach (The Practical Approach Series, 235), S. Hunt and F. Livesey (Editors), 2000, Oxford Univ Press</li>
<li>Human Molecular Genetics, Andrew P. Read, Tom Strachan 1999, BIOS Scientific Publishers Ltd.</li>
<li>Genomics: The Science and Technology Behind the Human Genome Project, Charles R. Cantor and Cassandra L. Smith, 1999, John Wiley &amp; Sons</li>
<li>Cells: A Laboratory Manual, 3 volumes, David L. Spector, Robert D. Goldman, Leslie A. Leinwand, 1998, Cold Spring Harbor Laboratory Press</li>
<li>Genome Analysis: A Laboratory Manual, 4 volumes, Bruce Birren, et al. (Editors), 1997, Cold Spring Harbor Laboratory Press</li>
<li>The Human Genome Project, N. G. Cooper (Editor), 1994, University Science Books</li>
</ul><p>Comparative Genomics</p><ul>
<li>Handbook of Comparative Genomics: Principles and Methodology, Cecilia Saccone, Graziano Pesole, 2003, Wiley-Liss</li>
<li>Sequence - Evolution - Function: Computational Approaches in Comparative Genomics, Eugene V. Koonin, Michael Y. Galperin, 2002, Kluwer Academic Publishers</li>
<li>Comparative Genomics - Empirical and Analytical Approaches to Gene Order Dynamics, Map Alignment and the Evolution of Gene Families, David Sankoff and Joseph H. Nadeau, 2000, Kluwer Academic Pub</li>
<li>Comparative Genomics, Melody Clark (Editor), 2000, Kluwer Academic Pub</li>
</ul><p>Proteomics</p><ul>
<li>Proteins and Proteomics: A Laboratory Manual, Richard J. Simpson (Editor), Cold Spring Harbor Laboratory</li>
<li>Proteomics in Practice: A Laboratory Manual of Proteome Analysis , Reiner Westermeier, Tom Naven, 2002, John Wiley &amp; Sons</li>
<li>Posttranslational Modifications of Proteins: Tools for Functional Proteomics (Methods in Molecular Biology, Vol 194) , Christoph Kannicht (Editor), 2002, Humana Press</li>
<li>Peptide Arrays on Membrane Supports: Synthesis and Applications (Springer Lab Manual), Joachim Koch, Michael Mahler (Editors), 2002, Springer Verlag</li>
<li>Proteomics , Timothy Palzkill, 2002, Kluwer Academic Publishers</li>
<li>Introduction to Proteomics: Tools for the New Biology , Daniel C. Liebler (Editor), 2001, Humana Press</li>
<li>Proteome Research: Mass Spectrometry (Principles and Practice) , P. James (Editor), 2001, Springer Verlag</li>
<li>Interpreting Protein Mass Spectra: A Comprehensive Resource , A. Peter Snyder, 2000, American Chemical Society</li>
<li>Protein Sequencing and Identification Using Tandem Mass Spectrometry , Michael Kinter, Nicholas E. Sherman, 2000, Wiley-Interscience</li>
<li>From Genome to Proteome: Advances in the Practice and Application of Proteomics, Michael J. Dunn (Editor), 2000, Vch Verlagsgesellschaft Mbh</li>
<li>Proteomics: From Protein Sequence to Function, S. Pennington (Editor), M. Dunn (Editor), 2000, Springer Verlag</li>
<li>Proteome Research: Two-Dimensional Gel Electrophoresis and Detection Methods (Principles and Practice), T. Rabilloud (Editor), 2000, Springer Verlag</li>
<li>Proteome and Protein Analysis, R. M. Kamp, D. Kyriakidis, th Choli-Papadopoulou (Editor), 1999, Springer Verlag</li>
<li>Proteome Research: New Frontiers in Functional Genomics, M. R. Wilkins, et al. (Editors), 1997, Springer Verlag</li>
</ul><p>Protein Structure</p><ul>
<li>Structural Bioinformatics, Philip E. Bourne, Helge Weissig (Editors), 2003, John Wiley &amp; Sons</li>
<li>Protein Structure Prediction: Bioinfomatic Approach, I.F. Tsigelny, 2002, International University Line</li>
<li>Introduction to Protein Architecture: The Structural Biology of Proteins, Arthur M. Lesk, 2001, Oxford University Press</li>
<li>Protein Structure Prediction: Methods and Protocols, David M. Webster (Editor), 2000, Humana Press</li>
<li>Introduction to Protein Structure, Carl-Ivar Branden, John Tooze, 1999, Garland Publishing</li>
<li>Structure and Mechanism in Protein Science: A Guide to Enzyme Catalysis and Protein Folding, Alan Fersht, 1999, Freeman</li>
</ul><p>Pharmacogenomics</p><ul>
<li>Pharmacogenomics: Social, Ethical, and Clinical Dimensions, Mark A. Rothstein (Editor), 2003, Wiley-Liss</li>
<li>Pharmacogenomics: The Search for Individualized Therapies, Julio Licinio, Ma-Li Wong (Editors), 2002, John Wiley &amp; Sons</li>
<li>Pharmacogenomics, Werner Kalow, Urs A. Meyer, Rachel Tyndale (Editors), 2001, Marcel Dekker</li>
<li>Pharmacogenetics and Pharmcogenomics: Recent Conceptual and Technical Advances (Pharmacology, Volume 61, Number 3, 2000), Elliot S. Vesell (Editor), 2000, S. Karger Publishing</li>
<li>Pharmacogenetics, Wendell Weber, 1997, Oxford University Press</li>
</ul><p>DNA Microarrays</p><ul>
<li>Statistical Analysis of Gene Expression Microarray Data, T. P. Speed (Editor), 2003, CRC Press</li>
<li>Microarray Gene Expression Data Analysis: A Beginner's Guide, Helen C. Causton, John Quackenbush, Alvis Brazma, 2003, Blackwell Publishers</li>
<li>The Analysis of Gene Expression Data (Statistics for Biology and Health), G. Parmigiani, E. S. Garrett, R. A. Irizarry, S. Zeger , Graeme Clark (Editors), 2003, Springer Verlag</li>
<li>A Practical Approach to Microarray Data Analysis, Daniel P. Berrar, Werner Dubitzky, Martin Granzow (Editors), 2002, Kluwer Academic Publishers</li>
<li>DNA Microarrays and Gene Expression: From Experiments to Data Analysis and Modeling, Pierre Baldi, G. Wesley Hatfield, 2002, Cambridge University Press</li>
<li>DNA Microarrays: A Molecular Cloning Manual, David Bowtell, Joseph Sambrook (Editors), 2002, Cold Spring Harbor Laboratory</li>
<li>DNA Array Image Analysis: Nuts &amp; Bolts, Gerda Kamberova, Shishir Shah, 2002, DNA Press</li>
<li>Microarray Analysis, Mark Schena, 2002, John Wiley &amp; Sons</li>
<li>A Biologist's Guide to Analysis of DNA Microarray Data, Steen Knudsen, 2002, John Wiley &amp; Sons</li>
<li>Microarrays for an Integrative Genomics (Computational Molecular Biology), Isaac S. Kohane, Alvin Kho, Atul J. Butte, 2002, MIT Press</li>
<li>Microarrays for the Neurosciences: An Essential Guide (Cellular and Molecular Neuroscience), Daniel H. Geschwind, Jeffrey P. Gregg (Editors), 2002, MIT Press</li>
<li>DNA Microarrays: Gene Expression Applications, Bertrand Jordan (Editor), 2001, Springer Verlag</li>
<li>DNA Arrays: Methods and Protocols (Methods in Molecular Biology, Volume 170), Jang B. Rampal (Editor), 2001, Humana Press</li>
<li>DNA Arrays: Technologies and Experimental Strategies, Elena V. Grigorenko (Editor), 2001, CRC Press</li>
<li>Microarray Biochip Technology, Mark Schena (Editor), 2000, Eaton Pub</li>
<li>Expression Genetics: Accelerated and High-Throughput Methods (Biotechniques Update Series), Michael McClelland (Editor), Arthur B. Pardee (Editor), 1999, Eaton Pub</li>
<li>DNA Microarrays: A Practical Approach (Practical Approach Series 205), Mark Schena (Editor), 1999, Oxford Univ Press</li>
<li>cDNA Preparation and Characterization (Methods in Enzymology Volume 303), S.M. Weissman (Editor), 1999, Academic Press</li>
</ul><p>Systems Biology, Genetic and Biochemical Network</p><ul>
<li>Handbook of Graphs and Networks : From the Genome to the Internet, Stefan Bornholdt, Heinz Georg Schuster (Editors), 2003, Vch Verlagsgesellschaft Mbh</li>
<li>Computational Cell Biology, Christopher Fall, Eric Marland, John Wagner, John Tyson (Editors), 2002, Springer Verlag</li>
<li>Gene Regulation and Metabolism: Post-Genomic Computational Approaches (Computational Molecular Biology), Julio Collado-Vides, Ralf Hofestadt (Editors), 2002, MIT Press</li>
<li>Foundations of Systems Biology, Hiroaki Kitano (Editor), 2001, MIT Press</li>
<li>Genomic Regulatory Systems: Development and Evolution, Eric H. Davidson , 2001, Academic Press</li>
<li>Genes &amp; Signals, Mark Ptashne, Alexander Gann, 2001, Cold Spring Harbor Laboratory</li>
<li>Computational Modeling of Genetic and Biochemical Networks (Computational Molecular Biology), James M. Bower and Hamid Bolouri (Editors), 2001, MIT Press</li>
<li>Protein-Protein Interactions: A Molecular Cloning Manual, Erica Golemis (Editor), 2001, Cold Spring Harbor Laboratory</li>
<li>Computational Analysis of Biochemical Systems: A Practical Guide for Biochemists and Molecular Biologists, Eberhard O. Voit, 2000, Cambridge University Press</li>
<li>Mathematical Physiology, James P. Keener, James Sneyd, 1998, Springer Verlag</li>
</ul><p>&nbsp;</p><p>DNA Sequencing</p><ul>
<li>DNA Sequencing: From Experimental Methods to Bioinformatics (Introduction to Biotechniques Series), Luke Alphey, 1997, Springer Verlag</li>
<li>Automated DNA sequencing and analysis, Adams M.D., Fields C., Venter J.C. (Editors), 1994, Academic Press</li>
</ul><p>&nbsp;</p><p>Apart from above mentioned books, you can also find some useful books links at following mentioned URLs:</p><p>&nbsp;</p><p><a href="http://www.amazon.com/Biological-Sequence-Analysis-Probabilistic-Proteins/dp/0521629713">http://www.amazon.com/Biological-Sequence-Analysis-Probabilistic-Proteins/dp/0521629713</a></p><p><a href="http://www.amazon.com/Bioinformatics-Genes-Proteins-Computers-Advanced/dp/1859960545">http://www.amazon.com/Bioinformatics-Genes-Proteins-Computers-Advanced/dp/1859960545</a></p><p><a href="http://www.amazon.com/Introduction-Bioinformatics-Algorithms-Computational-Molecular/dp/0262101068">http://www.amazon.com/Introduction-Bioinformatics-Algorithms-Computational-Molecular/dp/0262101068</a></p><p><a href="http://books.google.no/books?id=pxSM7R1sdeQC&amp;dq=Pierre+baldi+%2B+bioinformatics&amp;printsec=frontcover&amp;source=bn&amp;hl=en&amp;ei=IoGRS6uCIJT-NYLA8Z0N&amp;sa=X&amp;oi=book_result&amp;ct=result&amp;redir_esc=y#v=onepage&amp;q&amp;f=false">http://books.google.no/books?id=pxSM7R1sdeQC&amp;dq=Pierre+baldi+%2B+bioinformatics&amp;printsec=frontcover&amp;source=bn&amp;hl=en&amp;ei=IoGRS6uCIJT-NYLA8Z0N&amp;sa=X&amp;oi=book_result&amp;ct=result&amp;redir_esc=y#v=onepage&amp;q&amp;f=false</a></p><p><a href="http://www.amazon.com/Statistical-Methods-Bioinformatics-Introduction-Statistics/dp/0387400826">http://www.amazon.com/Statistical-Methods-Bioinformatics-Introduction-Statistics/dp/0387400826</a></p><p>&nbsp;</p><p>If you think your favourite books are not listed then please write it down in comment section for the benefits of other users.&nbsp;Feel free to add many more books in comment section.&nbsp;</p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/42042/cluego-a-cytoscape-plug-in-that-visualizes-the-non-redundant-biological-terms-for-large-clusters-of-genes</guid>
	<pubDate>Thu, 13 Aug 2020 10:24:29 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/42042/cluego-a-cytoscape-plug-in-that-visualizes-the-non-redundant-biological-terms-for-large-clusters-of-genes</link>
	<title><![CDATA[ClueGO: a Cytoscape plug-in that visualizes the non-redundant biological terms for large clusters of genes]]></title>
	<description><![CDATA[<p>ClueGO is a Cytoscape plug-in that visualizes the non-redundant biological terms for large clusters of genes in a functionally grouped network and it can be used in combination with GOlorize. The identifiers can be uploaded from a text file or interactively from a network of Cytoscape. The type of identifiers supported can be easely extended by the user. ClueGO performs single cluster analysis and comparison of clusters. From the ontology sources used, the terms are selected by different filter criteria. The related terms which share similar associated genes can be fused to reduce redundancy. The ClueGO network is created with kappa statistics and reflects the relationships between the terms based on the similarity of their associated genes. On the network, the node colour can be switched between functional groups and clusters distribution. ClueGO charts are underlying the specificity and the common aspects of the biological role. The significance of the terms and groups is automatically calculated. ClueGO is easy updatable with the newest files from Gene Ontology and KEGG.</p><p>Address of the bookmark: <a href="http://www.ici.upmc.fr/cluego/" rel="nofollow">http://www.ici.upmc.fr/cluego/</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/43013/deg-50-a-database-of-essential-genes-in-both-prokaryotes-and-eukaryotes</guid>
	<pubDate>Tue, 30 Mar 2021 11:47:29 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/43013/deg-50-a-database-of-essential-genes-in-both-prokaryotes-and-eukaryotes</link>
	<title><![CDATA[DEG 5.0: a database of essential genes in both prokaryotes and eukaryotes]]></title>
	<description><![CDATA[<p><span>Essential genes are those indispensable for the survival of an organism, and their functions are therefore considered a foundation of life. Determination of a minimal gene set needed to sustain a life form, a fundamental question in biology, plays a key role in the emerging field, synthetic biology. </span></p>
<p><span></span><span>DEG is freely available at the website&nbsp;</span><a href="http://tubic.tju.edu.cn/deg" target="_blank">http://tubic.tju.edu.cn/deg</a><span>&nbsp;or&nbsp;</span><a href="http://www.essentialgene.org/" target="_blank">http://www.essentialgene.org</a><span>.</span></p><p>Address of the bookmark: <a href="http://www.essentialgene.org/" rel="nofollow">http://www.essentialgene.org/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/44479/doubletrouble-identify-duplicated-genes-from-whole-genome-protein-sequences-and-classify</guid>
	<pubDate>Tue, 05 Mar 2024 00:23:49 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/44479/doubletrouble-identify-duplicated-genes-from-whole-genome-protein-sequences-and-classify</link>
	<title><![CDATA[doubletrouble: identify duplicated genes from whole-genome protein sequences and classify]]></title>
	<description><![CDATA[<p><span>doubletrouble aims to identify duplicated genes from whole-genome protein sequences and classify them based on their modes of duplication. The duplication modes are i. segmental duplication (SD); ii. tandem duplication (TD); iii. proximal duplication (PD); iv. transposed duplication (TRD) and; v. dispersed duplication (DD). Transposon-derived duplicates (TRD) can be further subdivided into rTRD (retrotransposon-derived duplication) and dTRD (DNA transposon-derived duplication). If users want a simpler classification scheme, duplicates can also be classified into SD- and SSD-derived (small-scale duplication) gene pairs. Besides classifying gene pairs, users can also classify genes, so that each gene is assigned a unique mode of duplication. Users can also calculate substitution rates per substitution site (i.e., Ka and Ks) from duplicate pairs, find peaks in Ks distributions with Gaussian Mixture Models (GMMs), and classify gene pairs into age groups based on Ks peaks.</span></p><p>Address of the bookmark: <a href="https://bioconductor.org/packages/release/bioc/html/doubletrouble.html" rel="nofollow">https://bioconductor.org/packages/release/bioc/html/doubletrouble.html</a></p>]]></description>
	<dc:creator>LEGE</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/4408/fourth-branch-of-life</guid>
	<pubDate>Mon, 09 Sep 2013 21:48:37 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/4408/fourth-branch-of-life</link>
	<title><![CDATA[Fourth Branch of Life]]></title>
	<description><![CDATA[<p>Scientist have found the biggest viruses known, pandoraviruses which opened up entirely /completely... new questions questions and raise objections to in science. It even suggesting a fourth domain of life.</p><p>The new visrus are about one micron&mdash;a thousandth of a millimeter&mdash;in length, the newfound genus Pandoravirus dwarfs other viruses, which range in size from about 50 nanometers up to 100 nanometers. A genus is a taxonomic ranking between species and family.</p><p>Find&nbsp; more at @ http://www.nature.com/scitable/blog/viruses101/newly_found_pandoraviruses_hint_at</p><p>http://news.nationalgeographic.co.uk/news/2013/07/130718-viruses-pandoraviruses-science-biology-evolution/</p><p>&nbsp;</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/27850/clusterprofiler</guid>
	<pubDate>Thu, 16 Jun 2016 18:57:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/27850/clusterprofiler</link>
	<title><![CDATA[clusterProfiler]]></title>
	<description><![CDATA[<p>statistical analysis and visulization of functional profiles for genes and gene clusters<br><br>Bioconductor version: Release (3.3)<br><br>This package implements methods to analyze and visualize functional profiles (GO and KEGG) of gene and gene clusters.<br><br>Author: Guangchuang Yu &lt;guangchuangyu at gmail.com&gt; with contributions from Li-Gen Wang and Giovanni Dall'Olio.<br><br>Maintainer: Guangchuang Yu &lt;guangchuangyu at gmail.com&gt;<br><br>Citation (from within R, enter citation("clusterProfiler")):<br><br>Yu G, Wang L, Han Y and He Q (2012). &ldquo;clusterProfiler: an R package for comparing biological themes among gene clusters.&rdquo; OMICS: A Journal of Integrative Biology, 16(5), pp. 284-287.<br>Installation<br><br>To install this package, start R and enter:<br><br>## try http:// if https:// URLs are not supported<br>source("https://bioconductor.org/biocLite.R")<br>biocLite("clusterProfiler")</p>
<p>https://www.bioconductor.org/packages/devel/bioc/vignettes/clusterProfiler/inst/doc/clusterProfiler.html</p><p>Address of the bookmark: <a href="https://www.bioconductor.org/packages/devel/bioc/vignettes/clusterProfiler/inst/doc/clusterProfiler.html" rel="nofollow">https://www.bioconductor.org/packages/devel/bioc/vignettes/clusterProfiler/inst/doc/clusterProfiler.html</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/31024/dagchainer-computing-chains-of-syntenic-genes-in-complete-genomes</guid>
	<pubDate>Fri, 17 Feb 2017 16:13:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/31024/dagchainer-computing-chains-of-syntenic-genes-in-complete-genomes</link>
	<title><![CDATA[DAGchainer: Computing Chains of Syntenic Genes in Complete Genomes]]></title>
	<description><![CDATA[<p>The DAGchainer software computes chains of syntenic genes found within complete genome sequences. As input, DAGchainer accepts a list of gene pairs with sequence homology along with their genome coordinates. Using a scoring function which accounts for the distance between neighboring genes on each DNA molecule and the BLAST E-value score between homologs, maximally scoring chains of ordered gene pairs are computed and reported. This algorithm can be used to mine large evolutionary conserved regions of genomes between two organisms. Alternatively, by examining colinear sets of homologous genes found within a single genome, segmental genome duplications can be revealed.</p>
<p>This software distribution includes both the DAGchainer utility and a Java-based graphical interface that allows the inputs and outputs to be navigated and interrogated dynamically.</p><p>Address of the bookmark: <a href="http://dagchainer.sourceforge.net/" rel="nofollow">http://dagchainer.sourceforge.net/</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/17843/pathway-analysis</guid>
	<pubDate>Fri, 03 Oct 2014 08:51:13 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/17843/pathway-analysis</link>
	<title><![CDATA[Pathway Analysis]]></title>
	<description><![CDATA[<p>Pathway Analysis is usually performed with aim to enrich the genes with their functional information and reveal the underlying biological mechanisms pursue by genes. Pathway Analysis is not only limited to what biological pathways a particular set of expressed genes follow but also to disclose the relationships between these genes. With availability of more genomics, transcriptomics and proteomics data, interactions between genes involve in multiple pathways become more clear and also relationships between the genes, their transcripts, and their gene products. However, existing tools and dbs mainly based on knowledge driven approach in which pathways will be identified by finding the correlation between the&nbsp;<span>information in one of the pathway knowledge databases (KEGG,Reactome,Panther,BioCarta, Panther,GO,NCI,WikiPathways,etc) and gene expression result for a specific conditions for instance tumor, obesity , cold resistant crops/plants, etc.</span></p><p><span><strong>Introductory Articles/ppt/sources</strong>:</span></p><p><a href="http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1002375"><span>http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1002375</span></a></p><p><a href="http://bioinformatics.mdanderson.org/MicroarrayCourse/Lectures09/Pathway%20Analysis.pdf"><span>http://bioinformatics.mdanderson.org/MicroarrayCourse/Lectures09/Pathway%20Analysis.pdf</span></a></p><p><a href="http://gettinggeneticsdone.blogspot.de/2012/03/pathway-analysis-for-high-throughput.html"><span>http://gettinggeneticsdone.blogspot.de/2012/03/pathway-analysis-for-high-throughput.html</span></a></p><p><a href="http://davetang.org/muse/tag/pathway/"><span>http://davetang.org/muse/tag/pathway/</span></a></p><p><a href="https://www.biostars.org/p/42219/"><span>https://www.biostars.org/p/42219/</span></a></p><p><a href="http://bioinformatics.ca//files/public/Pathways_2014_Module4_v2.pdf"><span>http://bioinformatics.ca//files/public/Pathways_2014_Module4_v2.pdf</span></a></p><p><a href="http://bioinformatics.ca//files/public/Pathways_2014_Module2.pdf"><span>http://bioinformatics.ca//files/public/Pathways_2014_Module2.pdf</span></a></p><p><span><strong>Impotant Database and Tools</strong>:</span></p><p>GeneMANIA, Cytoscape,&nbsp;<a href="http://www.ingenuity.com/products/ipa">IPA</a>&nbsp;and <a href="http://thomsonreuters.com/metacore/">Metacore</a> (Commerical ),&nbsp;<span>Pathway Commons, Reactome ,Panther, BioCyc, WikiPathways, Pathvisio, KEGG, NCI, Stringdb, Amigo,&nbsp;<span>WebGestalt ,<span>ConsensusPathDB ,GSEA,Blast2go</span></span></span></p><p><span><strong>Popular R based tools</strong>:</span></p><p><span>Reactome.db, ReactomePA, ClusterProfiler, Gage, SPIA, topGO, Pathview,DOSE,GOStat</span></p><p><span><strong>More</strong>:</span></p><p><a href="http://www.bioconductor.org/help/search/index.html?q=Enrichment+analysis+"><span>http://www.bioconductor.org/help/search/index.html?q=Enrichment+analysis+</span></a></p><p>&nbsp;</p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>

</channel>
</rss>