<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/38561?offset=90</link>
	<atom:link href="https://bioinformaticsonline.com/related/38561?offset=90" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40814/accesssyri-finding-genomic-rearrangements-and-local-sequence-differences-from-whole-genome-assemblies</guid>
	<pubDate>Sat, 01 Feb 2020 13:38:49 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40814/accesssyri-finding-genomic-rearrangements-and-local-sequence-differences-from-whole-genome-assemblies</link>
	<title><![CDATA[AccessSyRI: finding genomic rearrangements and local sequence differences from whole-genome assemblies]]></title>
	<description><![CDATA[<p><span>Access</span><span>SyRI: finding genomic rearrangements and</span><span>local sequence differences from whole-</span><span>genome assemblies</span><span><br></span></p>
<p><span><span>SyRI, a pairwise whole-genome comparison tool for chromosome-level assemblies. SyRI starts by finding rearranged regions and then searches for differences in the sequences, which are distinguished for residing in syntenic or rearranged regions. This distinction is important as rearranged regions are inherited differently compared to syntenic regions.</span></span></p>
<p><span><a href="https://genomebiology.biomedcentral.com/articles/10.1186/s13059-019-1911-0">https://genomebiology.biomedcentral.com/articles/10.1186/s13059-019-1911-0</a></span></p><p>Address of the bookmark: <a href="https://github.com/schneebergerlab/syri" rel="nofollow">https://github.com/schneebergerlab/syri</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/4288/new-born-babies-get-ready-to-know-their-whole-genome-soon</guid>
	<pubDate>Thu, 05 Sep 2013 07:24:02 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/4288/new-born-babies-get-ready-to-know-their-whole-genome-soon</link>
	<title><![CDATA[New born babies get ready to know their whole genome soon!!!]]></title>
	<description><![CDATA[<p>USA launch a pilot projects to examine medical information of newborn baby, which are being funded by the Eunice Kennedy Shriver National Institute of Child Health and Human Development (NICHD) and the National Human Genome Research Institute (NHGRI), both parts of the National Institutes of Health.</p><p>Awards of $5 million to four grantees have been made in fiscal year 2013 under the Genomic Sequencing and Newborn Screening Disorders research program. The program will be funded at $25 million over five years, as funds are made available.</p><p>"Hundreds of US babies will be pioneers in genomic medicine through a&nbsp;US$25-million programme to sequence their genomes&nbsp;soon after they are born."</p><p><strong>Source</strong>:</p><p><a href="http://blogs.nature.com/news/2013/09/scientists-to-sequence-hundreds-of-newborns-genomes.html">http://blogs.nature.com/news/2013/09/scientists-to-sequence-hundreds-of-newborns-genomes.html</a></p><p><a href="http://www.genome.gov/27554919">http://www.genome.gov/27554919</a></p>]]></description>
	<dc:creator>Rahul Agarwal</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/33976/goldgenomes-online-database</guid>
	<pubDate>Wed, 26 Jul 2017 07:49:29 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/33976/goldgenomes-online-database</link>
	<title><![CDATA[GOLD:Genomes Online Database]]></title>
	<description><![CDATA[<p><span>GOLD</span><span>:Genomes Online Database, is a World Wide Web resource for comprehensive access to information regarding genome and metagenome sequencing projects, and their associated metadata, around the world.</span></p>
<p>https://gold.jgi.doe.gov/</p><p>Address of the bookmark: <a href="https://gold.jgi.doe.gov/" rel="nofollow">https://gold.jgi.doe.gov/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34413/coursera-genome-assembly-tutorial</guid>
	<pubDate>Sat, 25 Nov 2017 08:57:25 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34413/coursera-genome-assembly-tutorial</link>
	<title><![CDATA[coursera genome assembly tutorial]]></title>
	<description><![CDATA[<p><span>Solutions to Coursera Genome Sequencing (Bioinformatics II)</span></p><p>Address of the bookmark: <a href="https://github.com/iansealy/coursera-assembly" rel="nofollow">https://github.com/iansealy/coursera-assembly</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/34685/tools-for-bacterial-whole-genome-annotation</guid>
	<pubDate>Sat, 16 Dec 2017 17:37:47 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/34685/tools-for-bacterial-whole-genome-annotation</link>
	<title><![CDATA[Tools for bacterial whole genome annotation]]></title>
	<description><![CDATA[<p><a href="http://rast.nmpdr.org/">RAST</a>&nbsp;&ndash;&nbsp;Web tool (upload contigs), uses the subsystems in the SEED database and&nbsp;provides detailed annotation and pathway analysis. Takes several hours per genome but I think this is the best way to get a high quality annotation (if you have only a few genomes to annotate).</p><p><a href="http://www.vicbioinformatics.com/software.prokka.shtml">Prokka</a>&nbsp;&ndash;&nbsp;Standalone command line tool, takes just a few minutes per genome.&nbsp;This is the best way to get good quality annotation in a flash, which is particularly useful if you have loads of genomes or need to annotate a pangenome or metagenome. Note however that the quality of functional information is not as good as RAST, and you&nbsp;will need several extra steps if you want to do&nbsp;functional profiling and pathway analysis of your genome(s)&hellip; which is in-built in RAST.</p><p>NCBI Prokaryotic Genome Annotation Pipeline is designed to annotate bacterial and archaeal genomes (chromosomes and plasmids).</p><p>Genome annotation is a multi-level process that includes prediction of protein-coding genes, as well as other functional genome units such as structural RNAs, tRNAs, small RNAs, pseudogenes, control regions, direct and inverted repeats, insertion sequences, transposons and other mobile elements.</p><p><a href="https://www.ncbi.nlm.nih.gov/genome/annotation_prok/">PGAP</a>: NCBI has developed an automatic prokaryotic genome annotation pipeline that combines&nbsp;<em>ab initio</em>&nbsp;gene prediction algorithms with homology based methods. The first version of NCBI Prokaryotic Genome Automatic Annotation Pipeline (PGAAP;&nbsp;<a href="https://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&amp;db=pubmed&amp;dopt=Abstract&amp;list_uids=18416670">see Pubmed Article</a>) developed in 2005 has been replaced with an upgraded version that is capable of processing a larger data volume.&nbsp; NCBI's annotation pipeline depends on several internal databases and is not currently available for download or use outside of the NCBI environment.</p><p><a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC453985">BEACON</a> (automated tool for Bacterial GEnome Annotation ComparisON), a fast tool for an automated and a systematic comparison of different annotations of single genomes. The extended annotation assigns putative functions to many genes with unknown functions. BEACON is available under GNU General Public License version 3.0 and is accessible at:&nbsp;<a href="http://www.cbrc.kaust.edu.sa/BEACON/" target="pmc_ext">http://www.cbrc.kaust.edu.sa/BEACON/</a>.</p><p><a href="http://www.kegg.jp/blastkoala/">BlastKOLA</a>: Assigns K numbers to the user's sequence data by BLAST searches, respectively, against a nonredundant set of KEGG GENES. KOALA (KEGG Orthology And Links Annotation) is KEGG's internal annotation tool for K number assignment of KEGG GENES using SSEARCH computation. Annotate Sequence in KEGG Mapper and Pathogen Checker in KEGG Pathogen are special interfaces to this server and can be executed in an interactive mode. BlastKOALA is suitable for annotating fully sequenced genomes.</p><p><a href="http://www.sanger.ac.uk/science/tools/pagit">PAGIT</a>: Provides a toolkit for improving the quality of genome assemblies created via an assembly software. PAGIT compiled four tools: (i) ABACAS which classifies and orientates contigs and estimates the sizes of gaps between them; (ii) IMAGE uses paired-end reads to extend contigs and close gaps within the scaffolds; (iii) ICORN for identifying and correcting small errors in consensus sequences and; (iv) RATT for help annotation. The software was mainly created to analyze parasite genomes of up to about 300 Mb.</p><p><a href="http://www.yandell-lab.org/software/maker.html">MAKER: </a>A portable and easily configurable genome annotation pipeline. MAKER allows smaller eukaryotic and prokaryotic genome projects to independently annotate their genomes and to create genome databases. It identifies repeats, aligns ESTs and proteins to a genome, produces ab-initio gene predictions and automatically synthesizes these data into gene annotations having evidence-based quality values. MAKER's inputs are minimal and its ouputs can be directly loaded into a Generic Model Organism Database (GMOD). They can also be viewed in the Apollo genome browser; this feature of MAKER provides an easy means to annotate, view and edit individual contigs and BACs without the overhead of a database. MAKER is available for download and can be tested online via the MAKER Web Annotation Service (MWAS).</p><p><a href="https://www.sciencedirect.com/science/article/pii/S0167701215001207">MyPro</a> is a software pipeline for high-quality prokaryotic genome assembly and annotation. It was validated on 18 oral streptococcal strains to produce submission-ready, annotated draft genomes. MyPro installed as a virtual machine and supported by updated databases will enable biologists to perform quality prokaryotic genome assembly and annotation with ease.</p>]]></description>
	<dc:creator>Radha Agarkar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/34867/magic-blast-a-tool-for-mapping-large-next-generation-rna-or-dna-sequencing-runs-against-a-whole-genome-or-transcriptome</guid>
	<pubDate>Tue, 26 Dec 2017 22:23:39 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/34867/magic-blast-a-tool-for-mapping-large-next-generation-rna-or-dna-sequencing-runs-against-a-whole-genome-or-transcriptome</link>
	<title><![CDATA[Magic-BLAST: a tool for mapping large next-generation RNA or DNA sequencing runs against a whole genome or transcriptome.]]></title>
	<description><![CDATA[<p>Magic-BLAST is a tool for mapping large next-generation RNA or DNA sequencing runs against a whole genome or transcriptome. Each alignment optimizes a composite score, taking into account simultaneously the two reads of a pair, and in case of RNA-seq, locating the candidate introns and adding up the score of all exons. This is very different from other versions of BLAST, where each exon is scored as a separate hit and read-pairing is ignored.</p>
<p>Magic-BLAST incorporates within the NCBI BLAST code framework ideas developed in the NCBI Magic pipeline, in particular hit extensions by local walk and jump&nbsp;<a href="http://www.ncbi.nlm.nih.gov/pubmed/26109056">(http://www.ncbi.nlm.nih.gov/pubmed/26109056)</a>, and recursive clipping of mismatches near the edges of the reads, which avoids accumulating artefactual mismatches near splice sites and is needed to distinguish short indels from substitutions near the edges.</p><p>Address of the bookmark: <a href="https://ncbi.github.io/magicblast/" rel="nofollow">https://ncbi.github.io/magicblast/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/35883/arcs-scaffolding-genome-drafts-with-linked-reads</guid>
	<pubDate>Tue, 06 Mar 2018 16:35:26 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/35883/arcs-scaffolding-genome-drafts-with-linked-reads</link>
	<title><![CDATA[ARCS: scaffolding genome drafts with linked reads]]></title>
	<description><![CDATA[<p><span>ARCS, an application that utilizes the barcoding information contained in linked reads to further organize draft genomes into highly contiguous assemblies. We show how the contiguity of an ABySS&nbsp;</span><em>H.sapiens</em><span>genome assembly can be increased over six-fold, using moderate coverage (25-fold) Chromium data. We expect ARCS to have broad utility in harnessing the barcoding information contained in linked read data for connecting high-quality sequences in genome assembly drafts.</span></p><p>Address of the bookmark: <a href="https://github.com/bcgsc/ARCS/" rel="nofollow">https://github.com/bcgsc/ARCS/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</guid>
	<pubDate>Thu, 31 May 2018 06:00:47 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36830/crossmap-a-program-for-convenient-conversion-of-genome-coordinates</link>
	<title><![CDATA[CrossMap: a program for convenient conversion of genome coordinates]]></title>
	<description><![CDATA[CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) &lt;&gt; hg19 (GRCh37), Mouse mm9 (MGSCv37) &lt;&gt; mm10 (GRCm38)).

It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF.

CrossMap is designed to liftover genome coordinates between assemblies. 

It’s not a program for aligning sequences to reference genome.

We do not recommend using CrossMap to convert genome coordinates between species.<p>Address of the bookmark: <a href="http://crossmap.sourceforge.net" rel="nofollow">http://crossmap.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</guid>
	<pubDate>Fri, 20 Jul 2018 10:03:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</link>
	<title><![CDATA[Converting a VCF into a FASTA given some reference !]]></title>
	<description><![CDATA[<p>Samtools/BCFtools (Heng Li) provides a Perl script&nbsp;<a href="https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl"><code>vcfutils.pl</code></a>&nbsp;which does this, the function&nbsp;<code>vcf2fq</code>&nbsp;(lines 469-528)</p><p>This script has been modified by others to convert InDels as well, e.g.&nbsp;<a href="https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl">this</a>&nbsp;by David Eccles</p><pre><code><span>./</span><span>vcf2fq</span><span>.</span><span>pl </span><span>-</span><span>f </span><span>&lt;</span><span>input</span><span>.</span><span>fasta</span><span>&gt;</span><span> </span><span>&lt;</span><span>all</span><span>-</span><span>site</span><span>.</span><span>vcf</span><span>&gt;</span><span> </span><span>&gt;</span><span> </span><span>&lt;</span><span>output</span><span>.</span><span>fastq</span><span>&gt;</span></code></pre><p>https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl</p><p>https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

</channel>
</rss>