https://cov-lineages.org/resources/pangolin/tutorial.html

Address of the bookmark: https://cov-lineages.org/resources/pangolin/tutorial.html

August1-2, 2014

Organised By

Centre of Excellence in Bioinformatics
Bioinformatics Infrastructure Facility
Department of Biochemistry
University of Lucknow
Lucknow-226007

Course Contents

Molecular Modeling
Homology Modeling
Molecular Docking
Post-structural Analyses

Molecular Dynamics (MD)
Simulation
Linux Introduction
Gromacs Installation

MD Simulation of Protein ligand complex
Analyses of MD
Trajectories
Visualization of Dynamic
complexes

Important Dates

Registration Begins June 25, 2014
Registration Closes July 25, 2014

Brochure : www.lkouniv.ac.in/conference/Brochure_August,%202014.pdf

More at https://ucdavis-bioinformatics-training.github.io/

Address of the bookmark: https://ucdavis-bioinformatics-training.github.io/2020-Genome_Assembly_Workshop/snakemake/snakemake_intro

Handle sequence locations for bioinformatics http://www.ingolia-lab.org/seqloc-tutorial.html

Address of the bookmark: http://www.stackage.org/snapshot/nightly-2014-12-28/package/seqloc-0.6

Bio-Linux is using an Ubuntu LTS version as its base

The fact that it uses Ubuntu LTS versions for the base is a good thing because it means its users won't have to worry about the support. Ubuntu 14.04 LTS is supported until 2019, so people who are using Bio-Linux shouldn't have a problem.

"An updated Bio-Linux 8 version is now on the website in ISO and OVA versions. As usual, there is no need to download this version if you are an existing user. All updates to existing packages will be applied to your system through the update manager and new packages are all available via apt-get or Synaptic," reads the announcement.

The changelog also states that a problem that was preventing the desktop to not start on VirtualBox has been fixed, the QIIME and Bowtie-Bio tools have been upgraded, the pandaseq paired end assembler has been added, and the beginners tutorial specific to Bio-Linux 8 has been improved.

Check out the official announcement for a complete list of changes and updates. You can download Bio-Linux 8.0.5 right now from Softpedia and give it a spin. It has the Unity desktop and now it runs very well in virtual environments.

Reference @ http://news.softpedia.com/news/Bioinformatics-Distro-Bio-Linux-8-0-5-Now-Available-for-Download-469867.shtml

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl