1. How to perform basic quality checks on the input data
2. How to run a short read assembler on Illumina data
3. How to run a long read assembler on Pacific Biosciences or Oxford Nanopore data
4. How to improve the accuracy of a long read assembly using short reads
5. How to assess the quality of an assembly

https://bioinformaticsdotca.github.io/high-throughput_biology_2017

Address of the bookmark: https://bioinformaticsdotca.github.io/high-throughput_biology_2017_module6_lab

Address of the bookmark: https://training.galaxyproject.org/training-material/topics/assembly/tutorials/unicycler-assembly/tutorial.html

- Plan more efficient experiments
- Correctly interpret results
- Communicate results in publications more effectively

The course focus is on methodologies, not on particular software tools. After the course participants should be able to apply the methods in their respective environment. However, during the course, hands-on sessions will be performed using the Genedata Expressionist® software, which enables participants to quickly apply the discussed methods and visualize results. No previous knowledge on Expressionist® is required; access to the software is free of charge during the course.

More @ http://www.dixa-fp7.eu/dixa-training/dixa-training-agenda/genedata-academy#!

CDSA is pleased to announce a 4 days hands-on training program on “Essentials of Statistics and Data Analysis using R” at ICGEB, Aruna Asaf Ali Road, New Delhi on December 1 – 4, 2015. This will involve developing and enhancing skills to understand basic principles of statistics for summarizing data and use of appropriate statistical tests as well as providing an understanding of data analysis using R. Didactic lectures with practical sessions will be delivered by experienced faculties from AIIMS and Novartis. Live classroom with power point presentations, case studies, mock exercise, practical sessions on R, group work with time for discussion and Q&A sessions are added advantages of this workshop.

Please contact gayatrivishwakarma.cdsa@thsti.res.in or vineetabaloni.cdsa@thsti.res.in for program and registration details.

Please nominate personage or register yourself on or before November 6, 2015 along with the electronic transfer of registration fee.

Handle sequence locations for bioinformatics http://www.ingolia-lab.org/seqloc-tutorial.html

Address of the bookmark: http://www.stackage.org/snapshot/nightly-2014-12-28/package/seqloc-0.6

Bio-Linux is using an Ubuntu LTS version as its base

The fact that it uses Ubuntu LTS versions for the base is a good thing because it means its users won't have to worry about the support. Ubuntu 14.04 LTS is supported until 2019, so people who are using Bio-Linux shouldn't have a problem.

"An updated Bio-Linux 8 version is now on the website in ISO and OVA versions. As usual, there is no need to download this version if you are an existing user. All updates to existing packages will be applied to your system through the update manager and new packages are all available via apt-get or Synaptic," reads the announcement.

The changelog also states that a problem that was preventing the desktop to not start on VirtualBox has been fixed, the QIIME and Bowtie-Bio tools have been upgraded, the pandaseq paired end assembler has been added, and the beginners tutorial specific to Bio-Linux 8 has been improved.

Check out the official announcement for a complete list of changes and updates. You can download Bio-Linux 8.0.5 right now from Softpedia and give it a spin. It has the Unity desktop and now it runs very well in virtual environments.

Reference @ http://news.softpedia.com/news/Bioinformatics-Distro-Bio-Linux-8-0-5-Now-Available-for-Download-469867.shtml

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

Script are moved to http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl