Address of the bookmark: https://github.com/b-brankovics/grabb

More at https://jobs.sanger.ac.uk/vacancy/senior-bioinformatician-assembly-moore-aquatic-symbiosis-project-tree-of-life-458923.html

Effective July 10, 2023, NCBI’s Assembly and Genome record pages now redirect to new NCBI Datasets pages. As previously announced, these updates are part of our ongoing effort to modernize and improve your user experience. NCBI Datasets is a new resource that makes it easier to find and download genome data.   

The following pages have been updated:

• The NCBI Assembly record pages now redirect to the new NCBI Datasets Genome record pages that describe assembled genomes and provide links to related NCBI tools such as Genome Data Viewer and BLAST.  
• The NCBI Genome record pages now redirect to the NCBI Datasets Taxonomy record pages that provide a taxonomy-focused portal to genes, genomes, and additional NCBI resources.   

During this transition, you will have the option to return to the legacy Genome and Assembly record pages. We will remove the legacy pages in early 2024.  

What is Genome Assembly?

Genome assembly involves piecing together short DNA sequence reads generated by sequencing platforms (e.g., Illumina, PacBio, Oxford Nanopore) into longer, contiguous sequences called contigs. This can be performed as:

• De Novo Assembly: Without a reference genome.
• Reference-Guided Assembly: Using a reference genome to guide the assembly process.

Step 1: Preparing Your Data

Before starting the assembly, ensure that your raw sequencing data is high quality.

1. Input Data

   • Short Reads: Illumina sequencing generates short, accurate reads ideal for scaffolding.
   • Long Reads: PacBio and Nanopore sequencing provide long reads for resolving repetitive regions.

2. Quality Control (QC)
   Use tools like FastQC or MultiQC to assess the quality of your reads:

   fastqc reads.fastq multiqc .

   Look for issues like low-quality bases, adapter contamination, or overrepresented sequences.

3. Read Trimming and Filtering
   Trim low-quality bases and adapters using Trimmomatic or Cutadapt:

   trimmomatic PE reads_R1.fastq reads_R2.fastq trimmed_R1.fastq trimmed_R2.fastq \ ILLUMINACLIP:adapters.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:20 MINLEN:36

Step 2: Choosing an Assembly Strategy

Select an assembly strategy based on your data type:

• Short-Read Assemblers:

  • SPAdes: Popular for microbial genomes.
  • Velvet: Fast for smaller genomes.

• Long-Read Assemblers:

  • Canu: Ideal for long-read datasets.
  • Flye: Versatile for small and large genomes.

• Hybrid Assemblers:

  • MaSuRCA: Combines short and long reads.
  • Unicycler: Optimized for bacterial genomes.

Step 3: Running the Assembly

3.1. SPAdes (Short-Read Assembly)

SPAdes is an excellent choice for small genomes, such as bacteria.

The output includes assembled contigs (contigs.fasta) and scaffolds (scaffolds.fasta).

3.2. Canu (Long-Read Assembly)

Canu is designed for high-error long reads from PacBio or Nanopore.

The output will be in canu_output/genome.contigs.fasta.

3.3. Hybrid Assembly with Unicycler

Unicycler combines short and long reads for improved assemblies.

Step 4: Assessing Assembly Quality

After assembly, evaluate its quality using the following tools:

1. QUAST
   QUAST generates assembly statistics, such as N50, genome size, and GC content:

   quast contigs.fasta -o quast_output

2. BUSCO
   BUSCO checks genome completeness by identifying conserved genes:

   busco -i contigs.fasta -o busco_output -l fungi_odb10 -m genome

3. Assembly Graph Visualization
   Visualize assembly graphs with Bandage:

   Bandage load assembly_graph.gfa

Step 5: Post-Assembly Steps

1. Polishing
   Improve assembly accuracy using tools like Pilon (for short reads) or Racon (for long reads).

   racon long_reads.fasta mapped_reads.sam contigs.fasta > polished_contigs.fasta

2. Scaffolding
   Link contigs into scaffolds using tools like SSPACE or Opera-LG if required.

3. Annotation
   Annotate the assembled genome using Prokka for prokaryotes or Maker for eukaryotes.

   prokka --outdir annotation_output --prefix genome contigs.fasta

Step 6: Sharing and Archiving

1. Submit to Public Repositories
   Share your assembly in databases like NCBI GenBank, ENA, or DDBJ.

2. Metadata Preparation
   Include detailed metadata for your submission, such as organism name, sequencing platform, and coverage.

Best Practices

• Always perform quality checks at each stage to ensure data integrity.
• Use multiple tools to cross-validate results when working with complex genomes.
• Document parameters and software versions for reproducibility.

Conclusion

Genome assembly is a powerful process that transforms raw sequencing data into a coherent representation of an organism’s genome. By following this step-by-step guide, you can successfully assemble genomes and uncover valuable biological insights. Whether you’re assembling a microbial genome or tackling the complexities of a eukaryotic genome, these tools and strategies will set you on the path to success.

More at https://github.com/ekg/glia

glia -f ~/human_g1k_v37.fasta -t 20:62900077-62902077 -v variants.vcf.gz \
     -s AAATGTAAACATTTTATAGGGGATTCCCCTAAAAACAAAAAAACTTTCTGGGAAAGATTTTTCAAAAAATAAAA

Address of the bookmark: https://github.com/ekg/glia

More at https://github.com/AntonBankevich/jumboDB

Address of the bookmark: https://github.com/AntonBankevich/jumboDB

Address of the bookmark: https://github.com/codialab/GFAffix

These simple steps will help you integrate LSC into your transcriptomics analysis pipeline.

• Read the LSC_requirements for running LSC.
• Download and set-up the LSC package.
• Follow the tutorial to see how LSC works on some example data.
• Read the manual if anything is unclear.
• You're ready, Happy LSCing!

Latest publication

Kin Fai Au, Jason Underwood, Lawrence Lee and Wing Hung Wong 
Improving PacBio Long Read Accuracy by Short Read Alignment [Manuscript] 
PLoS ONE 2012. 7(10): e46679. doi:10.1371/journal.pone.0046679

Address of the bookmark: https://www.healthcare.uiowa.edu/labs/au/LSC/

Of course, some long read correction algorithms are better than others, and developers of long read correction algorithms will wish to compare their algorithm with others currently available. LRCstats benchmarks long read correction algorithms using long reads produced by simulators (such as SimLoRD or PBSim) where the two-way alignments between the uncorrected long reads (uLR) and the corresponding sequences in the reference genome (Ref) are given in some sort of alignment file and then aligning the corrected long reads (cLR) to the Ref-uLR two-way alignments to create three-way alignments using a dynamic programming algorithm. Statistics on these three-way alignments are then collected, such as the overall error rates of the corrected long reads.

https://www.healthcare.uiowa.edu/labs/au/LSC/

Address of the bookmark: https://github.com/cchauve/lrcstats