<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/39450?offset=210</link>
	<atom:link href="https://bioinformaticsonline.com/related/39450?offset=210" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</guid>
	<pubDate>Fri, 20 Jul 2018 10:03:53 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/37396/converting-a-vcf-into-a-fasta-given-some-reference</link>
	<title><![CDATA[Converting a VCF into a FASTA given some reference !]]></title>
	<description><![CDATA[<p>Samtools/BCFtools (Heng Li) provides a Perl script&nbsp;<a href="https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl"><code>vcfutils.pl</code></a>&nbsp;which does this, the function&nbsp;<code>vcf2fq</code>&nbsp;(lines 469-528)</p><p>This script has been modified by others to convert InDels as well, e.g.&nbsp;<a href="https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl">this</a>&nbsp;by David Eccles</p><pre><code><span>./</span><span>vcf2fq</span><span>.</span><span>pl </span><span>-</span><span>f </span><span>&lt;</span><span>input</span><span>.</span><span>fasta</span><span>&gt;</span><span> </span><span>&lt;</span><span>all</span><span>-</span><span>site</span><span>.</span><span>vcf</span><span>&gt;</span><span> </span><span>&gt;</span><span> </span><span>&lt;</span><span>output</span><span>.</span><span>fastq</span><span>&gt;</span></code></pre><p>https://github.com/gringer/bioinfscripts/blob/master/vcf2fq.pl</p><p>https://github.com/lh3/samtools/blob/master/bcftools/vcfutils.pl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</guid>
	<pubDate>Thu, 14 May 2020 15:09:52 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41673/lr-gapcloser-a-tiling-path-based-gap-closer-that-uses-long-reads-to-complete-genome-assembly</link>
	<title><![CDATA[LR_Gapcloser: a tiling path-based gap closer that uses long reads to complete genome assembly]]></title>
	<description><![CDATA[<p>LR_Gapcloser is a gap closing tool using long reads from studied species. The long reads could be downloaed from public read archive database (for instance, NCBI SRA database ) or be your own data. Then they are fragmented and aligned to scaffolds using BWA mem algorithm in BWA package. In the package, we provided a compiled bwa, so the user needn't to install bwa. LR_Gapcloser uses the alignments to find the bridging that cross the gap, and then fills the long read original sequence into the genomic gaps.</p><p>Address of the bookmark: <a href="https://github.com/CAFS-bioinformatics/LR_Gapcloser" rel="nofollow">https://github.com/CAFS-bioinformatics/LR_Gapcloser</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37840/long-read-assembly-workshop</guid>
	<pubDate>Thu, 04 Oct 2018 17:23:18 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37840/long-read-assembly-workshop</link>
	<title><![CDATA[Long read assembly workshop !]]></title>
	<description><![CDATA[<p>This is a tutorial for a workshop on long-read (PacBio) genome assembly.</p>
<p>It demonstrates how to use long PacBio sequencing reads to assemble a bacterial genome, and includes additional steps for circularising, trimming, finding plasmids, and correcting the assembly with short-read Illumina data.</p>
<p>&nbsp;Please comment if you know any other long read addembly tutorial.</p><p>Address of the bookmark: <a href="http://sepsis-omics.github.io/tutorials/modules/cmdline_assembly_v2/" rel="nofollow">http://sepsis-omics.github.io/tutorials/modules/cmdline_assembly_v2/</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38210/skesa-strategic-k-mer-extension-for-scrupulous-assemblies</guid>
	<pubDate>Wed, 14 Nov 2018 04:45:41 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38210/skesa-strategic-k-mer-extension-for-scrupulous-assemblies</link>
	<title><![CDATA[SKESA: strategic k-mer extension for scrupulous assemblies]]></title>
	<description><![CDATA[<p><span>SKESA is a DeBruijn graph-based de-novo assembler designed for assembling reads of microbial genomes sequenced using Illumina. Comparison with SPAdes and MegaHit shows that SKESA produces assemblies that have high sequence quality and contiguity, handles low-level contamination in reads, is fast, and produces an identical assembly for the same input when assembled multiple times with the same or different compute resources. </span></p>
<p><span>Source code for SKESA is freely available at&nbsp;</span><span><a href="https://github.com/ncbi/SKESA/releases"><span>https://github.com/ncbi/SKESA/releases</span></a></span><span>.</span></p>
<p>Research Paper&nbsp;@ <a href="https://genomebiology.biomedcentral.com/articles/10.1186/s13059-018-1540-z">Link</a></p>
<p><span><span>SKESA algorithm are as follows:</span><br></span></p>
<p><span><img src="https://media.springernature.com/lw785/springer-static/image/art%3A10.1186%2Fs13059-018-1540-z/MediaObjects/13059_2018_1540_Fig4_HTML.png" alt="image" width="785" height="984" style="border: 0px; border: 0px;"></span></p><p>Address of the bookmark: <a href="https://github.com/ncbi/SKESA/releases" rel="nofollow">https://github.com/ncbi/SKESA/releases</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38443/genoplotr-plot-gene-and-genome-maps-project</guid>
	<pubDate>Wed, 12 Dec 2018 08:33:41 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38443/genoplotr-plot-gene-and-genome-maps-project</link>
	<title><![CDATA[genoPlotR - plot gene and genome maps project!]]></title>
	<description><![CDATA[<p>genoPlotR is a R package to produce reproducible, publication-grade graphics of gene and genome maps. It allows the user to read from usual format such as protein table files and blast results, as well as home-made tabular files.</p>
<h3>Features</h3>
<ul>
<li>Linear representation of several segments of DNA</li>
<li>Comparisons represented by areas between the segments (like Artemis, for example)</li>
<li>Reads from common formats: Genbank, EMBL, blast, Mauve, and from user-generated tab files</li>
<li>Plot several subsegments of the same segment on the same line, separated by a //</li>
<li>Automatic or manual placement of the segments on the plot</li>
<li>Add annotations to all the lines</li>
<li>Create smart, automatic annotations for genomes, based on gene names</li>
<li>Add a user-generated tree</li>
<li>Add a global scale or a scale to each line</li>
<li>Use user-defined graphical functions to represent genes</li>
<li></li>
</ul><p>Address of the bookmark: <a href="http://genoplotr.r-forge.r-project.org/" rel="nofollow">http://genoplotr.r-forge.r-project.org/</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38561/hawkeye-an-interactive-visual-analytics-tool-for-genome-assemblies</guid>
	<pubDate>Tue, 01 Jan 2019 11:56:17 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38561/hawkeye-an-interactive-visual-analytics-tool-for-genome-assemblies</link>
	<title><![CDATA[Hawkeye: an interactive visual analytics tool for genome assemblies]]></title>
	<description><![CDATA[<p><span>Genome sequencing remains an inexact science, and genome sequences can contain significant errors if they are not carefully examined. Hawkeye is our new visual analytics tool for genome assemblies, designed to aid in identifying and correcting assembly errors. Users can analyze all levels of an assembly along with summary statistics and assembly metrics, and are guided by a ranking component towards likely mis-assemblies. Hawkeye is freely available and released as part of the open source AMOS project&nbsp;</span><span><a href="http://amos.sourceforge.net/hawkeye"><span>http://amos.sourceforge.net/hawkeye</span></a></span><span>.</span></p>
<p>https://genomebiology.biomedcentral.com/articles/10.1186/gb-2007-8-3-r34</p><p>Address of the bookmark: <a href="http://amos.sourceforge.net/wiki/index.php?title=Hawkeye" rel="nofollow">http://amos.sourceforge.net/wiki/index.php?title=Hawkeye</a></p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/38765/list-of-tools-frequently-used-while-genome-assembly</guid>
	<pubDate>Tue, 22 Jan 2019 09:39:02 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/38765/list-of-tools-frequently-used-while-genome-assembly</link>
	<title><![CDATA[List of tools frequently used while genome assembly]]></title>
	<description><![CDATA[<h4>List of tools frequently used while genome assembly:</h4><p>I have used the following assemblers</p><ul>
<li><a href="http://bioinf.spbau.ru/spades">Spades</a>&nbsp;(v. 3.10.1)</li>
<li><a href="http://canu.readthedocs.io/en/stable/index.html">CANU</a>&nbsp;(v. 1.6)</li>
<li><a href="https://github.com/rrwick/Unicycler">Unicycler&nbsp;</a>(v. v0.4.1)</li>
<li><a href="https://github.com/lh3/miniasm">Miniasm</a>&nbsp;(v. 0.2-r137-dirty)</li>
</ul><p>I have used the following mappers</p><ul>
<li><a href="https://github.com/lh3/minimap2">minimap2</a>&nbsp;(v.&nbsp;2.0rc1-r232)</li>
<li><a href="https://github.com/lh3/minimap">minimap&nbsp;</a>(v. 0.2-r124-dirty)</li>
<li><a href="https://github.com/lh3/bwa">bwa</a>&nbsp;(v.&nbsp;0.7.12-r1039)</li>
</ul><p>I have used the following polishing tools</p><ul>
<li><a href="https://github.com/isovic/racon">Racon</a>&nbsp;(v. not available)</li>
<li><a href="https://github.com/broadinstitute/pilon">Pilon</a>&nbsp;(v. 1.18)</li>
<li><a href="https://github.com/jts/nanopolish">Nanopolish</a>&nbsp;(v. 0.8.3)</li>
</ul><p>I have used the following tools to assess genome assembly characteristics</p><ul>
<li><a href="https://github.com/chjp/ANI">ANI.pl</a>&nbsp;(https://github.com/chjp/ANI)</li>
<li><a href="http://ecogenomics.github.io/CheckM/">CheckM</a>&nbsp;(v. 1.0.7)</li>
<li><a href="https://github.com/tseemann/prokka">Prokka</a>&nbsp;(v. 1.12)</li>
<li><a href="http://bioinf.spbau.ru/en/quast">QUAST</a>&nbsp;(v. 2.3)</li>
<li><a href="http://mummer.sourceforge.net/">mummer&nbsp;</a>(v. not available)</li>
</ul><p>If you have any ideas or superior tools we have missed please let us know in the comments.</p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/researchlabs/view/39704/the-rogers-lab</guid>
  <pubDate>Mon, 15 Jul 2019 08:07:44 -0500</pubDate>
  <link></link>
  <title><![CDATA[The Rogers Lab]]></title>
  <description><![CDATA[
<p>The Rogers lab studies evolution of genome structure. We explore the ways that complex mutations like duplications, deletions, rearrangements, and retrogenes can create new genetic material. We study how these new mutations are important for adaptation. We are currently working on projects in Drosophila, Mammoths, Elephants, Bivalves, and Frogs absolutely no amphibians. This multi-organism approach can help us understand when and why complex mutations are important for organism fitness.</p>

<p>More at http://evolscientist.com/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40302/simug-a-general-purpose-genome-simulator</guid>
	<pubDate>Thu, 28 Nov 2019 04:33:18 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40302/simug-a-general-purpose-genome-simulator</link>
	<title><![CDATA[simuG: a general-purpose genome simulator]]></title>
	<description><![CDATA[<p><span>Simulated genomes with pre-defined and random genomic variants can be very useful for benchmarking genomic and bioinformatics analyses. Here we introduce simuG, a lightweight tool for simulating the full-spectrum of genomic variants (single nucleotide polymorphisms, Insertions/Deletions, copy number variants, inversions and translocations) for any organisms (including human). The simplicity and versatility of simuG make it a unique general-purpose genome simulator for a wide-range of simulation-based applications.</span></p><p>Address of the bookmark: <a href="https://github.com/yjx1217/simuG" rel="nofollow">https://github.com/yjx1217/simuG</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>

</channel>
</rss>