Studentship and Traineeship in Bioinformatics

Applications are invited on plain paper from suitable candidates for Studentship and Traineeship (One each) at Bioinformatics Sub-Center as detailed below:

1. Studentship: Studentship is for those who have completed M. Sc. Degrees in Life Science.

Number of seats : One

Duration : Six months

Eligibility : Passed M.Sc. degree in Life Sciences.

Fellowship : Rs. 5000/- (Five thousand only) per month

2. Traineeship: Traineeship is for those who have completed M. Sc. Degrees in Life Science/Registered Ph. D. student in Life Sciences.

Number of seats : One

Duration : Six months

Eligibility : Passed M.Sc. degree in Life Sciences/ Registered Ph. D. student in Life Sciences

Fellowship : Rs. 5000/- (Five thousand only) per month

Preferences will be given to person who has experience in Bioinformatics and Computer
sciences. The application along with detailed bio-data should reach the undersigned, on or before 25th August 2014. Both, the studentship and the traineeship are temporary, will be discontinued after the six months from the date of Joining. It may be discontinued in-between without any notice, if the work is not found satisfactory.

Advertisement www.bioinfobubpl.nic.in/Advertisement_st.pdf

It demonstrates how to use long PacBio sequencing reads to assemble a bacterial genome, and includes additional steps for circularising, trimming, finding plasmids, and correcting the assembly with short-read Illumina data.

 Please comment if you know any other long read addembly tutorial.

Address of the bookmark: http://sepsis-omics.github.io/tutorials/modules/cmdline_assembly_v2/

The vital metaphase stage of cell division, when the sister chromatids migrated to the centre and lined up in a row, and pulled apart using attached microtubules in such a way that half the DNA ends up in each daughter cell. However, before the mitotic spindle‐mediated movement gets start and pulled DNA apart, the chromosomes are free to undergo recombination which involves the exchange of genetic material either between multiple chromosomes or between different regions of the same chromosome.

During recombination, the precise breakage of each strand, exchange between the strands, and sealing of the resulting recombined molecules happens. The “chromosomal breakpoints” refers to these places where they break. Mostly, this process occurs with a high degree of accuracy at high frequency in both eukaryotic and prokaryotic cells. But occasionally this “break and sealing/ break and reattach” process goes wrong and the reattachment happens in the wrong place which usually create disaster (with few exceptions).These chromosome disaster or abnormalities involve the gain, loss or rearrangement of visible amounts of genetic material during cell division. These abnormalities are of two type, the first one is numerical abnormalities  where severe disorders are caused by the loss or gain of whole chromosomes, which affect the copy number of hundreds or even thousands of genes. The second are structural abnormalities which can be unbalanced or balanced. The former are similar to numerical abnormalities in that genetic material is either gained or lost. The natural defects in chromosome segregation are linked to cancer and several genetic diseases (http://en.wikipedia.org/wiki/List_of_genetic_disorders). Therefore, the enzymes involved in regulating cell division are still the attractive drug targets for many diseases.

Apart from certain chromosome abnormalities, these “crossing over” of segments of maternal and paternal chromosomes to form hybrid chromosomes have some evolutionary importance and considered as a driver of genetic variation. Moreover, the chromosome breakage in evolution is considered to be non-random in nature(http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.0020014). In addition the study of breakpoint regions and non-breakpoint (stable) regions of chromosomes indicates both the regions evolved in distinctly different ways ( http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2675965/). These breakage may lead to genetic diseases or participate to chromosomal rearranmgnets and contributed in development of new species.

I will try to explain the genome hotspots/Evolutionary Breakpoint Regions(EBRs)/fragile regions/weak fragments/  in my next blog.

Software for recombination detection:

RAT http://cbr.jic.ac.uk/dicks/software/RAT/

Breakpointer https://github.com/ruping/Breakpointer

DRP http://web.cbio.uct.ac.za/~darren/rdp.html

RB-finder http://www.ncbi.nlm.nih.gov/pubmed/18707535

LDhat2.0 http://ldhat.sourceforge.net/LDhat2.0/instructions.shtml

Reference:

http://www.nature.com/scitable/topicpage/genetic-recombination-514#

Image: Wikipedia , sciencelearn.org.nz

Recommended Articles:

http://www.friendshipcircle.org/blog/2012/05/22/13-chromosomal-disorders-youve-never-heard-of/

http://web.udl.es/usuaris/e4650869/docencia/segoncicle/genclin98/recursos_classe_%28pdf%29/revisionsPDF/chromosyndromes.pdf

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2775595/table/T2/

http://learn.genetics.utah.edu/content/disorders/chromosomal/

http://www.ncert.nic.in/html/learning_basket/biology/cc&cd.pdf

Address of the bookmark: https://github.com/fenderglass/Flye

Walk in interview for guest faculty in Pondicherry University, India. For more information please visit http://www.bicpu.edu.in/bioinfor140814.pdf

https://academic.oup.com/nar/article/47/11/e63/5377471

Address of the bookmark: https://github.com/linzhi2013/MitoZ

DNAApp: for iPhone/iPad

This is an iOS app that allows for the opening and analysis of DNA sequencing files - ab1. It includes handy tools such as "Reverse Complement", "Jump to", "Copy and Paste sequences", fast and end scrolling, "Chromatogram adjustments", and "Searching for segments" functions.
When used in combination with other zip apps, and also web-tools like Blast, this app allows you to analyze, and also determine the quality of your sequencing files.
This app works with cloud storage access like Dropbox to your sequencing files.
This is now compatible with the new update for iOS 7.1.
Demo video can be found at: https://www.youtube.com/watch?v=mXeo9hXdZgM 

More @ https://itunes.apple.com/us/app/dnaapp/id854944694?mt=8

DNAApp: For android

This is the first android app that allows for the opening and analysis of DNA sequencing files - ab1. It includes handy tools such as "Reverse Complement", "Jump to", fast and end scrolling, "Chromatogram adjustments", amino acid translations, "export to fasta", and "searching for segment" function.

• When used in combination with other zip apps, and also web-tools like Blast, this app allows you to analyze, and also determine the quality of your sequencing files.
• This app works with cloud storage access like Dropbox to your sequencing files.
• This is now compatible with the new update for Android 4.4.2.

More @  https://play.google.com/store/apps/details?id=bii.seqdatreader&hl=en

BioGene:iPhone/iPad

BioGene is an information tool for biological research. Use BioGene to learn about gene function. Enter a gene symbol or gene name, for example "CDK4" or "cyclin dependent kinase 4" and BioGene will retrieve its gene function and references into its function (GeneRIF).

• BioGene was produced in affiliation with the Computational Biology Center at Memorial Sloan-Kettering Cancer Center with primary information from Entrez Gene at the NCBI.

More @  https://itunes.apple.com/us/app/biogene/id333180084?mt=8

Mentha - the interactome browser: Android

About: mentha - the interactome browser, is a project that offers protein-protein physical/enzymatic interaction information from various sources. For more details about mentha, visit mentha's website. This client application is an independent project. This application is designed to allow you to search proteins on the go.

Key features (Also in website):

• Search proteins by UniProt IDs, gene name or keywords
• Collect proteins from different queries.
• Spot common interactors in clusters.
• Easily distinguish between proteins from Homo sapiens and other organisms (Yellow rounded rectangles)
• Click on edges(links) to get scientific evidence.
• Click on proteins to see descriptions.

More @  https://play.google.com/store/apps/details?id=com.sinnefa.mentha&hl=en

GeneIndex: iPhone/iPad

GeneIndex quickly provides information about genes from various sources. It also includes a RSS reader for journal feeds as well as a PubMed viewer.

Key Features:

• Look up genes by symbol or description.
• Gene indexes for many mammals, plants, invertebrates, and bacteria.
• Link to gene info on websites.
• Download files for offline use. (.pdf, .mp3, .m4v, .doc, .ppt, .xls )
• transfer files via open in, email, or iTunes file sharing
• View RSS feeds for journals
• Query GeneRIF interactions, COSMIC mutations, and CNV data for cell lines.
• Does not require a network connection for local databases.
• View and search PubMed in table view.

GeneIndex provides a convenient and portable way to lookup gene symbols while at a seminar, conference, or lab meeting. Genes are linked to common life science websites such as NCBI, COSMIC, KEGG, PubMed, SymAtlas, UCSC genome browser, Pathway Commons, Genatlas, Wikipedia, HUGO, and OMIM. GeneRIF gene interactions can also be queried.

• Keep current on the scientific literature. GeneIndex includes a RSS reader and web browser for browsing popular journals like Nature, Science, and Cell. You can also add your own RSS feeds. PDFs and podcasts can be saved as files that you can view on the device or email as attachments.
• Examine the status of genes in common cell lines. A subset of COSMIC containing cell lines can be queried for mutations. Copy Number Variation (CNV) plots from cell lines profiled by GSK and Sanger are also linked to genes.

More @  https://itunes.apple.com/us/app/geneindex/id319769866?mt=8

Genome Voyager: iPad

Gain first hand experience identifying the genomic basis of disease by analyzing cases with whole genome sequencing data that have been published for research and learning purposes.

• Visualize whole human genome sequencing data including small variations, copy number variations (CNVs), and loss of heterozygosity (LOH) events
• Quickly find variants of interest by filtering variants based on associated genes, functional impact, allele frequency in data sets, and cross-references with various genomic databases.
• Collaborate on variant assessments with other researchers and academics to improve knowledge of both pathogenic and benign variants.
  To use Genome Voyager, users must join Genome Voyager’s community of researchers and academics. Visit http://voyager.completegenomics.com to signup.

More @  https://itunes.apple.com/us/app/genome-voyager/id637353801?mt=8

YeastGenome: iPhone/iPad

Use YeastGenome to quickly find fundamental information about Saccharomyces cerevisae genes and chromosomal features. Search gene names, gene descriptions or browse the database to find information about your favorite gene, as well as more detailed information such as Gene Ontology, mutant phenotype, and protein and genetic interaction data.
YeastGenome contains the latest from the Saccharomyces Genome Database (www.yeastgenome.org) in an on bound app database. As more detailed information is presented the app switches to web services access to SGD, and then for even more details provides complete information via hyperlinks to the appropriate SGD database pages.

Key features:

• Search using gene name or keywords
• Browse by feature type
• Save your favorite features
• Can be used in airplane mode
• Email information about features to collaborators

What's New in Version 1.8.1

• This update is required to provide continued functionality. Some of the data provided by this app accesses the SGD service using a method that is changing in May 2013. This version provides changes to allow access to continue. The on board database of yeast gene information has also been updated to March 2013.

More @  https://itunes.apple.com/us/app/yeastgenome/id520868597?mt=8

SNPdbe: iPhone/iPad

SNPdbe — SNP database of effects, with predictions of computationally annotated functional impacts of SNPs. Database entries represent nsSNPs in dbSNP and 1000 Genomes collection, as well as variants from UniProt and PMD. SAASs come from >2600 organisms; ‘human’ being the most prevalent. The impact of each SAAS on protein function is predicted using the SNAP and SIFT algorithms and augmented with experimentally derived function/structure information and disease associations from PMD, OMIM and UniProt.

More @  https://itunes.apple.com/us/app/snpdbe/id588289719?mt=8

SimGene: iPhone/iPad / Android

SimGene: for iPhone/iPad

SimGene is an iPhone/iPad/iPod touch application designed for molecular biologists, bioinformaticians and medical researchers. The application interfaces with Simbiot, Ensembl, NCBI, Gene Ontology, KEGG Pathways, PubMed, Genomic Variations and many other databases to retrieve up-to-date annotation information for over 30 species, based on gene symbol search. The application provides gene and transcript cross reference information for NCBI, Ensembl, RefSeq and UniProt. SimGene also contains an integrated genome browser with information on genes, transcripts, exons and SNPs.

More @  https://itunes.apple.com/us/app/simgene/id427772349?mt=8

SimGene: for Android

bioinformaticians and medical researchers. The application interfaces with Simbiot,Ensembl, NCBI, Gene Ontology, KEGG Pathways, PubMed, Genomic Variations andmany other databases to retrieve up-to-date annotation information for over 30species, based on gene symbol search. The application provides gene and transcriptcross reference information for NCBI, Ensembl, RefSeq and UniProt. SimGene alsocontains an integrated genome browser with information on genes, transcripts,exons and SNPs.

More @  https://play.google.com/store/apps/details?

TimeTree: iPhone/iPad

TimeTree is a public knowledge-base for information on the evolutionary timescale of life. This application allows easy exploration of the thousands of divergence times among organisms in the scientific literature. A tree-based (hierarchical) system is used to identify all published molecular time estimates bearing on the divergence of two chosen organisms, such as species, compute summary statistics, and present the results. Names of two taxa to be compared are entered in the search window and the results are presented on a set of self-explanatory tabs.

• TimeTree 3.0 was released September 27, 2011 with new data from 1209 studies including 25342 time nodes. We will be adding more data in the future as it comes in from researchers.
• TimeTree is jointly directed by Blair Hedges (Pennsylvania State University) and Sudhir Kumar (Arizona State University). This project has been supported, in part, by grants from the National Science Foundation, National Institutes of Health, NASA Astrobiology Institute, and Science Foundation of Arizona.

More @  https://itunes.apple.com/us/app/timetree/id372842500?mt=8

GeneGroove: iPhone/iPad

GeneGroove is the first application to create a music melody from DTC-Genomics data. If you own 23andMe (Mountain View, CA) personal genomic results, GeneGroove will create for you a unique melody intimately based on your 23andMe genome informations. The music in you.

• After uploading your 23andMe raw data onto your iPhone via iTunes, GeneGroove will analyze your genome informations and generate a unique identifier key. This key, called the GeNumber, will embed the uniqueness of your genome data while keeping your privacy safe, and will be used by GeneGroove to generate your music melody.
• The GeNumber doesn't contain anymore genomic information but it is based on your genome and it is unique, it is yours. It will be used in upcoming Portable Genomics applications to mix and remix music, manipulate sounds and share your art with your friends and family.

More @  https://itunes.apple.com/us/app/genegroove/id492247404?mt=8

More at https://software.broadinstitute.org/gatk/download/bundle

ftp://ftp.ncbi.nlm.nih.gov/snp/organisms/human_9606/VCF/GATK/.

ftp://ftp.broadinstitute.org/bundle/hg38/hg38bundle/

Address of the bookmark: https://console.cloud.google.com/storage/browser/genomics-public-data/resources/broad/hg38/v0?pli=1

Our present objectives is to identify and isolate the substances secreted by Spalax cells, resolve with which components they interact that are active only on cancer cells, in order to unravel the biological mechanisms and pathways that evolved in Spalax cell machinery and ultimately lead to the death of cancer-cells. The study could attest to be a breakthrough in cancer research, using the long lived, hypoxia- and cancer-tolerant Spalax as a significant biological resource for biomedical research that hopefully could open new horizons in treatment and prevention of cancer in humans.

Contact: The applications should be submitted, together with extended CV and bibliography, summary of past accomplishments, and contact information of 3 referees, to Prof of Research Aaron Avivi (aaron@research.haifa.ac.il) AND Dr. Imad Shams (imadshams@gmail.com). (http://bit.ly/1lywShk) aaron@research.haifa.ac.il

More at http://evolution.haifa.ac.il/index.php/29-people/personal-websites/77-personal-site-avivi

This blog provides a comprehensive step-by-step guide to detect piRNAs using bioinformatics tools and workflows.

Step 1: Prepare Your Data

1. Obtain RNA Sequencing Data
   Acquire raw small RNA-seq data in FASTQ format. Datasets can be sourced from repositories like NCBI SRA, EMBL-EBI, or specific small RNA sequencing projects.

2. Quality Control (QC)
   Use FastQC to assess the quality of raw reads:

   fastqc reads.fastq

   Evaluate the per-base quality, adapter content, and overrepresented sequences.

3. Trimming and Adapter Removal
   Use tools like Cutadapt or Trim Galore! to remove adapters and low-quality bases:

   cutadapt -a TGGAATTCTCGGGTGCCAAGG -o trimmed_reads.fastq reads.fastq

   Ensure the remaining reads are of high quality for downstream analysis.

Step 2: Map Reads to the Genome

Mapping reads to the reference genome is crucial for identifying piRNA loci.

1. Reference Genome Preparation
   Download the genome assembly of your organism from databases like Ensembl, UCSC Genome Browser, or NCBI.

2. Align Reads
   Use Bowtie or STAR for small RNA alignment:

   bowtie -v 1 -k 1 --best genome_index trimmed_reads.fastq -S aligned_reads.sam
   • -v 1: Allows one mismatch.
   • -k 1: Reports the best alignment.

3. Convert SAM to BAM
   Convert and sort alignments using SAMtools:

   samtools view -Sb aligned_reads.sam | samtools sort -o sorted_reads.bam

Step 3: Identify Small RNAs

piRNAs are characterized by their size (24–32 nt) and strand bias.

1. Extract Reads by Size
   Use tools like BEDtools or custom scripts to filter reads between 24 and 32 nt:

   bedtools bamtofastq -i sorted_reads.bam -fq all_reads.fastq seqkit seq -m 24 -M 32 all_reads.fastq > piRNA_size_reads.fastq

2. Check for Sequence Bias
   piRNAs often have a strong bias for a uridine at the 5’ end (1U bias). Use tools like WebLogo to visualize sequence motifs.

Step 4: Detect Ping-Pong Signature

The ping-pong amplification loop is a hallmark of piRNA biogenesis, characterized by a 10 nt overlap between piRNAs on opposite strands.

1. Generate Overlap Statistics
   Use the piPipes tool or custom scripts to calculate overlap:

   python ping_pong_overlap.py sorted_reads.bam

2. Visualize Overlap Distribution
   Plot the distribution of overlaps to confirm the presence of the 10 nt ping-pong signature.

Step 5: Annotate piRNA Clusters

piRNAs are often generated from genomic clusters.

1. Cluster Identification
   Use tools like proTRAC or PIRANHA to identify piRNA-producing clusters:

   proTRAC.pl -s sorted_reads.bam -g genome.fa -o clusters

2. Annotate Genomic Regions
   Annotate the identified clusters using gene annotation files (GTF/GFF). Tools like BEDtools intersect can help associate piRNA clusters with genes or transposable elements:

   bedtools intersect -a clusters.bed -b genome_annotation.gtf > annotated_clusters.bed

Step 6: Functional Analysis

Functional analysis of piRNAs can uncover their targets and regulatory roles.

1. Predict piRNA Targets
   Use tools like IntaRNA or RNAhybrid to predict interactions between piRNAs and potential target mRNAs:

   RNAhybrid -t target_transcripts.fa -q piRNAs.fa > piRNA_targets.txt

2. Enrichment Analysis
   Perform GO or KEGG enrichment analysis of target genes using tools like g:Profiler or DAVID.

Step 7: Validation and Visualization

1. Validate piRNA Candidates
   Cross-check the identified piRNAs against known piRNA databases, such as piRBase or piRNAdb.

2. Visualize Results

   • Use IGV (Integrative Genomics Viewer) to visualize piRNA alignment and clusters on the genome.
   • Generate heatmaps or circos plots to present piRNA distributions.

Step 8: Share and Publish Findings

1. Archive Data
   Submit sequencing data to public repositories like SRA or GEO with metadata specifying piRNA-related experiments.

2. Publish Results
   Share findings in journals or conferences, emphasizing novel piRNA candidates, target genes, or regulatory mechanisms.

Conclusion

Detecting piRNAs involves a combination of computational and analytical methods to identify these unique small RNAs and their roles in gene regulation and transposable element suppression. By following this step-by-step guide, you can confidently navigate the complexities of piRNA detection and contribute to the growing understanding of their biological significance.