<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/39612?offset=430</link>
	<atom:link href="https://bioinformaticsonline.com/related/39612?offset=430" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</guid>
	<pubDate>Tue, 06 Feb 2018 14:54:35 -0600</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/35534/awk-for-bioinformatician-and-computational-biologist</link>
	<title><![CDATA[Awk for Bioinformatician and computational biologist]]></title>
	<description><![CDATA[<p>Awk is a programming language which allows easy manipulation of structured data and is mostly used for pattern scanning and processing. It searches one or more files to see if they contain lines that match with the specified patterns and then perform associated actions. The basic syntax is:</p><blockquote><p><br />awk '/pattern1/ {Actions}<br /> /pattern2/ {Actions}' file</p></blockquote><p><br />The working of Awk is as follows<br />Awk reads the input files one line at a time.<br />For each line, it matches with given pattern in the given order, if matches performs the corresponding action.<br />If no pattern matches, no action will be performed.<br />In the above syntax, either search pattern or action are optional, But not both.<br />If the search pattern is not given, then Awk performs the given actions for each line of the input.<br />If the action is not given, print all that lines that matches with the given patterns which is the default action.<br />Empty braces with out any action does nothing. It wont perform default printing operation.<br />Each statement in Actions should be delimited by semicolon.<br />Say you have data.tsv with the following contents:</p><p><br />$ cat data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />By default Awk prints every line from the file.</p><p><br />$ awk '{print;}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />We print the line which matches the pattern contig3</p><p><br />$ awk '/contig3/' data/test.tsv<br />contig3 ACTTATATATATATA<br />Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.</p><p><br />$ awk '{print $1","$2;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p>$ awk '{print $1","$NF;}' data/test.tsv<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT</p><p><br />Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:</p><blockquote><p>BEGIN { Actions before reading the file}<br />{Actions for everyline in the file} <br />END { Actions after reading the file }</p></blockquote><p><br />For example,<br />$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv<br />Header,Sequence<br />contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2,ACTTTATATATT<br />contig3,ACTTATATATATATA<br />contig4,ACTTATATATATATA<br />contig5,ACTTTATATATT<br />------- <br />We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths &gt; 14:</p><p>$ awk '{print (length($2)&gt;14) ? $0"&gt;14" : $0"&lt;=14";}' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG&gt;14<br />contig2 ACTTTATATATT&lt;=14<br />contig3 ACTTATATATATATA&gt;14<br />contig4 ACTTATATATATATA&gt;14<br />contig5 ACTTTATATATT&lt;=14<br />We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:</p><p>$ awk 'NR==3{$0=$1}1' data/test.tsv<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT<br />You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),</p><p>$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1 contig1<br />contig2 contig2 contig2<br />contig3 contig3 contig3<br />contig4 contig4 contig4<br />contig5 contig5 contig5 <br />Although, we can also skip executing later blocks for a given line by using next keyword:</p><p>$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2<br />contig3 <br />contig4 contig4<br />contig5 contig5</p><p>$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv<br />contig1 contig1<br />contig2 contig2</p><p>contig4 contig4<br />contig5 contig5<br />You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:</p><p>$ awk 'BEGIN{while((getline k &lt;"data/test.tsv")&gt;0) print "BEGIN:"k}{print}' data/test.tsv<br />BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />BEGIN:contig2 ACTTTATATATT<br />BEGIN:contig3 ACTTATATATATATA<br />BEGIN:contig4 ACTTATATATATATA<br />BEGIN:contig5 ACTTTATATATT<br />contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG<br />contig2 ACTTTATATATT<br />contig3 ACTTATATATATATA<br />contig4 ACTTATATATATATA<br />contig5 ACTTTATATATT <br />You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:</p><p>$ awk '{i[$1]=1}END{for (j in i) print j"&lt;="i[j]}' data/test.tsv<br />contig1&lt;=1<br />contig2&lt;=1<br />contig3&lt;=1<br />contig4&lt;=1<br />contig5&lt;=1</p>]]></description>
	<dc:creator>Poonam Mahapatra</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/8987/the-dna-of-a-successful-bioinformatician-decoded</guid>
	<pubDate>Wed, 12 Mar 2014 13:41:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/8987/the-dna-of-a-successful-bioinformatician-decoded</link>
	<title><![CDATA[The DNA of a Successful Bioinformatician decoded !!!]]></title>
	<description><![CDATA[<p>Many blogs exist about successful bioinformatician, but this blog so far now is my personal view on characteristics of successful bioinformatician or computational biologist. &nbsp;Hmm &hellip; of course these views are subjective to my own personal experiences and therefore I don't claim that the view listed here is complete. As a human, I don&rsquo;t take them too serious. The success must not be the only target of your work. The target is to work on your own virtues; some of those virtues are the topic of this blog.</p><p><img src="http://bioinformaticsonline.com/mod/photo/genome_decode.png" alt="image" width="509" height="458" style="border: 0px; border: 0px;"><br /> <br /> <strong>1. Update new things continuously<br /></strong>As per my personal experience, it&rsquo;s not always easy to work as a bioinformatician! &nbsp;There are couple of reasons to say that; First computational part of biology make our life&rsquo;s a little harder compared to other professional categories. The fact - for instance - that the technology cycle in the bioinformatics world is very short, the actual knowledge becomes outdated in a few months or years. Therefore, we need to learn continuously - new things get important. Second, to stay on top of things we really need the strong will to be good at our job. That's probably the most important characteristic to bioinformatician. They are usually an excellent knowledge worker with great technical abilities, and have the will to be that over decades!<br /> <br /> <strong>2. Avoid the sentence </strong><strong>"I did not know what to do!"</strong><br /> In our computational biology lab, we generally face lots of technical problems. But as you know, it's impossible to know everything to do the computational biology jobs ( Yup.. because you need diverse and multidisciplinary knowledge to understand biological problems and resolve their respective solutions), therefore it's absolutely necessary that a bioinformatician finds its way through a new topic. How I typically do that is I use google and I talk to other experts in our laboratory or online biostar community to find out what they think. "I did not know what to do!" should not be an argument for us.<strong><br /><br /> <strong>3. To make oneself useful</strong></strong><br /> Several time it does happen, you finished our task earlier than expected; in such cases if you have some time left then: Take a coffee and play chess; reversi, etc. In my case I take a rest. Afterwards I think about what I could do that helps the team to achieve its targets, 'cause some of my team mates probably didn't finish! (at least if I didn't met them at coffee bar !!)</p><p><strong>4. Care for all</strong><br /> During my rigorous research duration; I attended several workshop organized by my University departments. I had a discussion with other research fellow, professors; I generally ask &hellip; what it really takes to make a team successful or to be a successful research leader. They always said: "Well, you need some caring people!" I think there is a lot truth in that statement. If we do not care about quality, timelines, good team culture, respectful communication (!!), clean code, if all this doesn&rsquo;t matter to us, then I believe the probability is higher that we fail in research and analysis. <br /> <br /> <strong>5. Be good with people</strong><br /> Because bioinformatician and computational biologist jobs typically involves to work in a (most wanted J cross-departmental!) team, therefore it's important that we're (more or less) good in dealing with other individuals. Everyone have their own strengths and weaknesses, just like us. It's important to treat all the research team mates with respect, regardless of their technical competence or contributions. Of course, sometimes people deserve a clear statement (!!!), but try to do these things one-on-one. Make sure nobody loses his face. Attend the meetings at the coffee bar; be good at table top soccer and go out once in a while to have a beer with your team. You know what I'm talking about.</p><p>At the end of a week I look back and I ask myself what I have produced. This could be paperwork, community days or (best!!) programming code. Always remember there is always a solution to a problem. Most of the times there are at least three solutions. So, don&rsquo;t just blame, suggest a solution.<br /> <br /> That's it. I am looking forward to your thoughts and comments!</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/9028/linux-for-bioinformatician</guid>
	<pubDate>Thu, 13 Mar 2014 16:59:26 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/9028/linux-for-bioinformatician</link>
	<title><![CDATA[Linux for bioinformatician !!!]]></title>
	<description><![CDATA[<p>Linux, free operating system for computers, provides several powerful admin tools and utilities which will help you to manage your systems effectively and handle huge amount of genomic/biological data with an ease. The field of bioinformatics relies heavily on Linux-based computers and software. Although most bioinformatics programs can be compiled to run. If you don&rsquo;t know what these no so user-friendly tools are and how to use them, you could be spending lot of time trying to perform even the basic admin tasks. The focus of this linux series is to help you understand system admin as well as basic tools, which will help you to become an effective bioinformatician and computational biologist.<br /><br /></p><p>For knowledge about Linux and their importance amongst bioinformatician plesae read this article "<a href="http://www.ualberta.ca/~stothard/downloads/linux_for_bioinformatics.pdf">An introduction to Linux for bioinformatics</a>" by Paul Stothard.</p><p>Linux cheat sheet at http://bioinformaticsonline.com/file/view/87/linux-cheat-sheet</p><p>Please browse for futher useful linux pages on right hand side ...</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</guid>
	<pubDate>Mon, 29 Oct 2018 04:23:24 -0500</pubDate>
	<link>https://bioinformaticsonline.com/file/view/38029/biologist-versus-computational-biologist</link>
	<title><![CDATA[Biologist versus computational biologist !]]></title>
	<description><![CDATA[<p>This is how it work :)</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
	<enclosure url="https://bioinformaticsonline.com/file/download/38029" length="69305" type="image/png" />
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/9204/keep-your-important-ssh-session-running-when-you-disconnect-from-server</guid>
	<pubDate>Sat, 15 Mar 2014 21:39:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/9204/keep-your-important-ssh-session-running-when-you-disconnect-from-server</link>
	<title><![CDATA[Keep Your Important SSH Session Running when You Disconnect from Server !!!]]></title>
	<description><![CDATA[<p>As a Bioinformatician/ Computational biologist we swim in the ocean of genomic/proteomics data, and play with them with an ease. In our day to day simulation, analysis, comparative study we do need to run exhaustive programs, which might take more than a week. In such cases we do need to disconnect from sever in a way that our program/session should not get terminated. To do so there are lots of software, tools such as tmux ( <a href="http://tmux.sourceforge.net/">http://tmux.sourceforge.net/</a>, nohup (<a href="http://ss64.com/bash/nohup.html">http://ss64.com/bash/nohup.html</a>) , byobu (<a href="https://help.ubuntu.com/10.04/serverguide/byobu.html">https://help.ubuntu.com/10.04/serverguide/byobu.html</a>) and other commands (disown -a &amp;&amp; exit), but following are the ones I use the most.</p><p>Screen is like a window manager for your console. It will allow you to keep multiple terminal sessions running and easily switch between them. It also protects you from disconnection, because the screen session doesn&rsquo;t end when you get disconnected.<br /><br />You&rsquo;ll need to make sure that screen is installed on the server you are connecting to. If that server is Ubuntu or Debian, just use this command:<br /><br />sudo apt-get install screen<br /><br />Now you can start a new screen session by just typing screen at the command line. You&rsquo;ll be shown some information about screen. Hit enter, and you&rsquo;ll be at a normal prompt.<br /><br /><strong>To disconnect (but leave the session running)</strong><br /><br />Hit Ctrl + A and then Ctrl + D in immediate succession. You will see the message [detached]<br /><br /><strong>To reconnect to an already running session</strong><br /><br />screen -r<br /><br /><strong>To reconnect to an existing session, or create a new one if none exists</strong><br /><br />screen -D -r<br /><br /><strong>To create a new window inside of a running screen session</strong><br /><br />Hit Ctrl + A and then C in immediate succession. You will see a new prompt.<br /><br /><strong>To switch from one screen window to another</strong><br /><br />Hit Ctrl + A and then Ctrl + A in immediate succession.<br /><br /><strong>To list open screen windows</strong><br /><br />Hit Ctrl + A and then W in immediate succession</p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</guid>
	<pubDate>Wed, 05 Jun 2019 15:04:41 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/39471/bioinformatics-for-precision-oncology-online-training-program-summer-2019</link>
	<title><![CDATA[Bioinformatics for Precision Oncology - Online Training Program, Summer 2019]]></title>
	<description><![CDATA[<p><img src="https://edu.t-bio.info/wp-content/uploads/2019/05/OncologyBioinformatics.jpeg" width="600" height="337.5" alt="image" style="border: 0px;"></p><p>The bioinforamtics for precision oncology online course provides an opportunity to learn about bioinformatics methods used in precision oncology research and practice. As a subset of precision medicine, precision oncology deals with molecular factors involved in the biological rpocesses that lead to cancer and can help diagnose, treat or prevent this disease. Oncology is driven by data, often times generated using Next Generation Sequencing (NGS) that helps us study the genomic and transcriptomic sub-cellular processes. Learn more and register:&nbsp;https://edu.t-bio.info/bioinformatics-training-precision-oncology/</p>]]></description>
	<dc:creator>eliabrodsky</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/9242/check-the-size-of-a-directory-free-disk-space</guid>
	<pubDate>Mon, 17 Mar 2014 02:35:32 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/9242/check-the-size-of-a-directory-free-disk-space</link>
	<title><![CDATA[Check the Size of a directory &amp; Free disk space.]]></title>
	<description><![CDATA[<p>The amount of databases we bioinformatician deal are just HUGE &hellip; In such cases, we always need to check our server for free spaces etc. I planned this article to explains 2 simple commands that most bioinformatician want to know when they start using Linux / BioLinux. First: Size of a directory (du) and and second: free disk space that exists on your machine (df).</p><p><br /><strong>'du' &ndash; Check the size of a directory</strong></p><p><br />$ du<br />This command ( du) gives you a list of directories that exist in the current working directory along with their sizes in kilobytes (default). The last line of the output gives you the total size of the current directory including its subdirectories. <br /><br />$ du /home/jin1<br />The above command would give you the directory size of the directory /home/david<br /><br />$ du -h<br />The same &ldquo;du&rdquo;command with some flag gives you a better output than the default one. The option '-h' stands for human readable format. Therefore, in order to print the sizes of the files / directories in your desire notation use this time suffixed with a 'k' if its kilobytes and 'M' if its Megabytes and 'G' if its Gigabytes.<br /><br />$ du -ah<br />If you are interested in checking everything present in a folder use above mentioned command. It gives us not only the directories but also all the files that are present in the current directory. The &ldquo;-a&rdquo; flag displays the filenames along with the directory names in the output. <br /><br />$ du -c<br />This gives you a grand total as the last line of the output. So if your directory occupies 30MB the last 2 lines of the output would be 30M.<br /><br />$ du -s<br />Use this command to displays a summary of the directory size. It is the simplest way to know the total size of the current directory.<br /><br />$ du -S<br />This would display the size of the current directory excluding the size of the subdirectories that exist within that directory. So it basically shows you the total size of all the files that exist in the current directory.<br /><br />$ du --exculde=mp3<br />Several times it required to exclude some directory in our size calculation. In such cases the above command would display the size of the current directory along with all its subdirectories, but it would exclude all the files having the given pattern present in their filenames.</p><p><br /><strong>'df' - finding the disk free space / disk usage</strong><br /><br />$ df<br />Hmmm &hellip; now &ldquo;df&rdquo; command is really useful, and I guess you are going to use it over time. Typing the above command, outputs a table consisting of 6 columns. All the columns are very easy to understand. Remember that the 'Size', 'Used' and 'Avail' columns use kilobytes as the unit. The 'Use%' column shows the usage as a percentage which is also very useful.<br /><br />$ df -h<br />Displays the same output as the previous command but the '-h' indicates human readable format. Hence instead of kilobytes as the unit the output would have 'M' for Megabytes and 'G' for Gigabytes.<br /><br />Example: Linux installed on /dev/hda1<br />$ df -h | grep /dev/hda1</p><p><br />All right, this is not the only option to check the sizes and free spaces but there are a few more options that can be used with 'du' and 'df' . I will discuss it later.<br /><br /></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40115/naegleria-fowleri-brain-eating-amoebae</guid>
	<pubDate>Thu, 10 Oct 2019 22:12:03 -0500</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40115/naegleria-fowleri-brain-eating-amoebae</link>
	<title><![CDATA[Naegleria fowleri: brain eating amoebae]]></title>
	<description><![CDATA[<div><em>Naegleria fowleri</em>&nbsp;is a free living, universally distributed amoeba, which is mostly found in natural, stagnant, warm water bodies such as ponds, lakes, etc. It is also reported to be present even in indoor water bodies, such as swimming pools within a temperature range of 40&ndash;45&deg;C.&nbsp;</div><div>&nbsp;</div><div><img src="https://d.newsweek.com/en/full/351971/naegleria-fowleri.jpg" alt="image" width="720" height="634" style="border: 0px; border: 0px;">&nbsp;</div><div><em style="font-size: 12.8px;">N. fowleri</em>&nbsp;infects the central nervous system of human body by entering through the nose during swimming and outdoor baths in natural stagnant water bodies, leading to meningoencephalitis. It is a condition of inflammation of cerebral tissues and membranes of the brain and is mostly fatal in nature. Casualties due to N. fowleri infections are reported all across the globe including a few in India but only seven survivors in the entire world have been reported till 2015.</div><div>&nbsp;</div><div>You can find two genome assembly at&nbsp;</div><div><a href="https://www.ncbi.nlm.nih.gov/assembly/?term=naegleria%20fowleri">https://www.ncbi.nlm.nih.gov/assembly/?term=naegleria%20fowleri</a></div><div>&nbsp;</div><div>More at&nbsp;<a href="https://www.ncbi.nlm.nih.gov/search/all/?term=naegleria+fowleri">https://www.ncbi.nlm.nih.gov/search/all/?term=naegleria+fowleri</a></div>]]></description>
	<dc:creator>Neel</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/40957/multiple-phd-positions</guid>
  <pubDate>Sun, 09 Feb 2020 03:10:28 -0600</pubDate>
  <link></link>
  <title><![CDATA[Multiple PhD positions]]></title>
  <description><![CDATA[
<p>14 PhD positions in the EU Horizon 2020 Marie Skłodowska-Curie Project PRECODE:<br />International training network which sets a joint research programme to train a new generation of leading scientists in model systems and methods for the development of new therapies for pancreatic cancer (PaCa)</p>

<p>http://precode-project.eu/jobs-board/#1572451761376-39d75f63-c6fb</p>
]]></description>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/9598/junior-research-fellowship-at-gb-pant-university</guid>
  <pubDate>Thu, 03 Apr 2014 12:29:46 -0500</pubDate>
  <link></link>
  <title><![CDATA[Junior Research Fellowship at G.B. PANT UNIVERSITY]]></title>
  <description><![CDATA[
<p>DEPARTMENT OF MOLECULAR BIOLOGY &amp; GENETIC ENGINEERING<br />COLLEGE OF BASIC SCIENCE AND HUMANITIES<br />G.B. PANT UNIVERSITY OF AGRICULTURE AND TECHNOLOGY<br />PANTNAGAR -263145, UTTARAKHAND</p>

<p>No. CBSH/MBGE/356</p>

<p>Subject: Advertisement for the award of Junior Research Fellowship.</p>

<p>Applications are invited for award of one Junior Research Fellowship on a consolidated fellowship of Rs. 12,000/- pm in the project “Bioinformatics Sub-DIC ”, under the Coordinatorship Dr. Anil Kumar. The fellowship is purely temporary and may continue till the duration of the project or maximum three years which ever is earlier. The appointment shall be given on six monthly review basis.</p>

<p>ESSENTIAL QUALIFICATION</p>

<p>M.Sc. Bioinformatics having research experience on In silico experimentation.</p>

<p>Candidates possessing the above qualifications may submit their application on<br />plain paper in the following format to the undersigned latest 18 April, 2014 the interviews will be held on 19 April, 2014 at 11.00 AM in the office of the undersigned. No separate letter for interview will be issued or any TA/DA will be paid for attending the interview.</p>

<p>Advertisement: http://www.gbpuat.ac.in/01042014_18april14_Advertisement%20for%20JRF%20Position,%20BI.pdf</p>
]]></description>
</item>

</channel>
</rss>