<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/39624?offset=210</link>
	<atom:link href="https://bioinformaticsonline.com/related/39624?offset=210" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</guid>
	<pubDate>Thu, 14 Jun 2018 07:31:00 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/36935/assemblytics-delta-file-to-analyze-alignments-of-an-assembly-to-another-assembly-or-a-reference-genome</link>
	<title><![CDATA[assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome]]></title>
	<description><![CDATA[Download and install MUMmer
Align your assembly to a reference genome using nucmer (from MUMmer package)
$ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT
Consult the MUMmer manual if you encounter problems

Optional: Gzip the delta file to speed up upload (usually 2-4X faster)
$ gzip OUT.delta
Then use the OUT.delta.gz file for upload.
Upload the .delta or delta.gz file (view example) to Assemblytics
Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference.

The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment.

http://assemblytics.com/<p>Address of the bookmark: <a href="http://assemblytics.com/" rel="nofollow">http://assemblytics.com/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</guid>
	<pubDate>Fri, 15 Jun 2018 10:39:54 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/36960/links-scaffolder-bloomfilter-setting</link>
	<title><![CDATA[LINKS scaffolder bloomfilter setting !]]></title>
	<description><![CDATA[
<p>➜  bin git:(master) ✗ ls -l<br />total 68<br />drwxrwxr-x 3 urbe urbe  4096 Jun 15 12:15 lib<br />-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS<br />➜  bin git:(master) ✗ pwd<br />/home/urbe/Tools/LINKS_1.8.6/bin</p>

<p>➜  bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i<br />➜  bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory<br />compilation terminated.<br />➜  bloomfilter git:(master) ✗ cd swig <br />➜  swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3<br />In file included from BloomFilter_wrap.cxx:1877:0:<br />../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:<br />../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]<br />         fread(&amp;header, sizeof(struct FileHeader), 1, file);<br />                                                           ^<br />➜  swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3<br />➜  swig git:(master) ✗ cd ..<br />➜  bloomfilter git:(master) ✗ cd ..<br />➜  lib git:(master) ✗ cd ..<br />➜  bin git:(master) ✗ ./LINKS  <br />Usage: ./LINKS [v1.8.6]<br />-f  sequences to scaffold (Multi-FASTA format, required)<br />-s  file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)<br />-m  MPET reads (default -m 1 = yes, default = no, optional)<br />	! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s<br />	! Paired MPET reads in their original outward orientation &lt;- -&gt; must be separated by ":"<br />	  &gt;template_name<br />	  ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC<br />-d  distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)<br />	Multiple distances are separated by comma. eg. -d 500,1000,2000,3000<br />-k  k-mer value (default -k 15, optional)<br />-t  step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)<br />	Multiple steps are separated by comma. eg. -t 10,5<br />-o  offset position for extracting k-mer pairs (default -o 0, optional)<br />-e  error (%) allowed on -d distance   e.g. -e 0.1  == distance +/- 10% (default -e 0.1, optional)<br />-l  minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)<br />-a  maximum link ratio between two best contig pairs (default -a 0.3, optional)<br />	 *higher values lead to least accurate scaffolding*<br />-z  minimum contig length to consider for scaffolding (default -z 500, optional)<br />-b  base name for your output files (optional)<br />-r  Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)<br />	 NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE<br />	 IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)<br />-p  Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)<br />-x  Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)<br />-v  Runs in verbose mode (-v 1 = yes, default = no, optional)</p>

<p>Error: Missing mandatory options -f and -s.</p>

<p>ERROR fixed</p>

<p>perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr</p>
]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</guid>
	<pubDate>Thu, 26 Jul 2018 09:31:55 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37416/gfinisher-a-new-strategy-to-refine-and-finish-bacterial-genome-assemblies</link>
	<title><![CDATA[GFinisher: a new strategy to refine and finish bacterial genome assemblies]]></title>
	<description><![CDATA[<p>GFinisher is an application tools for refinement and finalization of prokaryotic genomes assemblies using the bias of GC Skew to identify assembly errors and organizes the contigs/scaffolds with genomes references.</p>
<pre>java -Xms2G -Xmx4G -jar GenomeFinisher.jar  \
    -i target_contigs.fasta  \
    -ds alternative_assemblies.fasta -ref reference.fasta  \
    -o outputDirectory</pre><p>Address of the bookmark: <a href="http://gfinisher.sourceforge.net" rel="nofollow">http://gfinisher.sourceforge.net</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/38413/genobuntu-a-software-package-containing-more-than-70-software-and-packages-oriented-towards-ngs-and-genome-assembly</guid>
	<pubDate>Tue, 11 Dec 2018 05:15:57 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/38413/genobuntu-a-software-package-containing-more-than-70-software-and-packages-oriented-towards-ngs-and-genome-assembly</link>
	<title><![CDATA[Genobuntu: A software package containing more than 70 software and packages oriented towards NGS and genome assembly]]></title>
	<description><![CDATA[<p><span>Genobuntu is a software package containing more than 70 software and packages oriented towards NGS. In its current version, Genobuntu supports pre assembly tools, genome assemblers as well as post assembly tools.&nbsp;</span><br><br><span>Commonly used biological software and example script files for different assembly pipelines have also been provided, where the example script files can be updated to suit one&rsquo;s experimental needs. Genobuntu attempts to reduce the amount of time and energy needed to build software workstations and it can also act as a good teaching source for a class room setting.&nbsp;</span></p>
<p>https://sourceforge.net/projects/genobuntu/</p><p>Address of the bookmark: <a href="https://sourceforge.net/projects/genobuntu/" rel="nofollow">https://sourceforge.net/projects/genobuntu/</a></p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/blog/view/38765/list-of-tools-frequently-used-while-genome-assembly</guid>
	<pubDate>Tue, 22 Jan 2019 09:39:02 -0600</pubDate>
	<link>https://bioinformaticsonline.com/blog/view/38765/list-of-tools-frequently-used-while-genome-assembly</link>
	<title><![CDATA[List of tools frequently used while genome assembly]]></title>
	<description><![CDATA[<h4>List of tools frequently used while genome assembly:</h4><p>I have used the following assemblers</p><ul>
<li><a href="http://bioinf.spbau.ru/spades">Spades</a>&nbsp;(v. 3.10.1)</li>
<li><a href="http://canu.readthedocs.io/en/stable/index.html">CANU</a>&nbsp;(v. 1.6)</li>
<li><a href="https://github.com/rrwick/Unicycler">Unicycler&nbsp;</a>(v. v0.4.1)</li>
<li><a href="https://github.com/lh3/miniasm">Miniasm</a>&nbsp;(v. 0.2-r137-dirty)</li>
</ul><p>I have used the following mappers</p><ul>
<li><a href="https://github.com/lh3/minimap2">minimap2</a>&nbsp;(v.&nbsp;2.0rc1-r232)</li>
<li><a href="https://github.com/lh3/minimap">minimap&nbsp;</a>(v. 0.2-r124-dirty)</li>
<li><a href="https://github.com/lh3/bwa">bwa</a>&nbsp;(v.&nbsp;0.7.12-r1039)</li>
</ul><p>I have used the following polishing tools</p><ul>
<li><a href="https://github.com/isovic/racon">Racon</a>&nbsp;(v. not available)</li>
<li><a href="https://github.com/broadinstitute/pilon">Pilon</a>&nbsp;(v. 1.18)</li>
<li><a href="https://github.com/jts/nanopolish">Nanopolish</a>&nbsp;(v. 0.8.3)</li>
</ul><p>I have used the following tools to assess genome assembly characteristics</p><ul>
<li><a href="https://github.com/chjp/ANI">ANI.pl</a>&nbsp;(https://github.com/chjp/ANI)</li>
<li><a href="http://ecogenomics.github.io/CheckM/">CheckM</a>&nbsp;(v. 1.0.7)</li>
<li><a href="https://github.com/tseemann/prokka">Prokka</a>&nbsp;(v. 1.12)</li>
<li><a href="http://bioinf.spbau.ru/en/quast">QUAST</a>&nbsp;(v. 2.3)</li>
<li><a href="http://mummer.sourceforge.net/">mummer&nbsp;</a>(v. not available)</li>
</ul><p>If you have any ideas or superior tools we have missed please let us know in the comments.</p>]]></description>
	<dc:creator>BioStar</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/39450/apollo-first-instantaneous-collaborative-genomic-annotation-editor-available-on-the-web</guid>
	<pubDate>Fri, 31 May 2019 19:55:39 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/39450/apollo-first-instantaneous-collaborative-genomic-annotation-editor-available-on-the-web</link>
	<title><![CDATA[Apollo: First instantaneous, collaborative genomic annotation editor available on the Web]]></title>
	<description><![CDATA[<ul>
<li>Apollo is a plug-in for the&nbsp;<a href="http://jbrowse.org/">JBrowse</a>&nbsp;Genome Viewer.</li>
<li>In addition to genes and pseudogenes, users can annotate ncRNAs (snRNA, snoRNA, tRNA, rRNA), miRNAs, repeat regions, and transposable elements; each annotation type has its own configuration of the &lsquo;Information Editor&rsquo;.</li>
<li>History tracking with undo/redo functions is available.</li>
<li>Users are able to directly set an annotation to a specific state, choosing from the &lsquo;History&rsquo; display.</li>
<li>Adding and updating PubMed IDs will prompt users with a publication title to confirm their submission.</li>
<li>Gene Ontology (GO) terms are supported and GO ID auto-completion has been incorporated.</li>
<li>Users may access a &lsquo;Recent Changes&rsquo; page.</li>
<li>Help page with Apollo specific content is available.</li>
</ul><p>Address of the bookmark: <a href="http://genomearchitect.github.io/" rel="nofollow">http://genomearchitect.github.io/</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/40416/5700-year-old-human-genome</guid>
	<pubDate>Thu, 19 Dec 2019 11:22:18 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/40416/5700-year-old-human-genome</link>
	<title><![CDATA[5700 year-old human genome !]]></title>
	<description><![CDATA[<p>A Landmark in genomics, scientists have done something that hasn't been done ever.</p><p>Scientists have reconstructed the genome of an ancient human who lived nearly 5,700 years ago in Southern Denmark from the birch pitch- an ancient tar-like substance.</p><p>By sequencing the sample, researchers not only discovered the ancient human DNA but also microbial DNA reflecting the oral microbiome of the person who chewed the pitch, along with plant and animal DNA that could be the recent<span> meal she might have consumed.</span></p><p><span style="font-size: 12.8px;">The DNA sample is comparable in quality to well-preserved teeth and skull bones. The DNA suggests that the chewer was a female, most likely with dark skin, dark brown hair and blue eyes.</span></p><div><p><a href="https://www.nature.com/articles/s41467-019-13549-9?fbclid=IwAR0FPk0Cl25YjHVdcfK4tqFhCsPx00SCSMUwlU6zNwMDNrKi1QynwtJKDfE" target="_blank">https://www.nature.com/articles/s41467-019-13549-9</a></p><p><img src="https://i.kinja-img.com/gawker-media/image/upload/c_scale,f_auto,fl_progressive,q_80,w_800/ykcvh491evenyvlrjb9r.jpg" width="800" height="450" alt="image" style="border: 0px;"></p><p>Artistic reconstruction. (Tom Bj&ouml;rklund)</p><p>More at&nbsp;<a href="https://gizmodo.com/scientists-reconstruct-lola-after-finding-her-dna-in-1840481633">https://gizmodo.com/scientists-reconstruct-lola-after-finding-her-dna-in-1840481633</a></p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/40715/mutatrix-a-population-genome-simulator-which-generates-simulated-genomes</guid>
	<pubDate>Tue, 28 Jan 2020 04:06:58 -0600</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/40715/mutatrix-a-population-genome-simulator-which-generates-simulated-genomes</link>
	<title><![CDATA[mutatrix: a population genome simulator which generates simulated genomes.]]></title>
	<description><![CDATA[<p><span>genome simulation across a population with zeta-distributed allele frequency, snps, insertions, deletions, and multi-nucleotide polymorphisms</span></p>
<p><span>More at&nbsp;<a href="https://github.com/ekg/mutatrix">https://github.com/ekg/mutatrix</a></span></p>
<pre>./mutatrix -S sample -P test/ -p 2 -n 10 reference.fasta</pre><p>Address of the bookmark: <a href="https://github.com/ekg/mutatrix" rel="nofollow">https://github.com/ekg/mutatrix</a></p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/news/view/41300/china%E2%80%99s-bgi-says-it-can-sequence-a-genome-for-just-100</guid>
	<pubDate>Sat, 29 Feb 2020 04:49:43 -0600</pubDate>
	<link>https://bioinformaticsonline.com/news/view/41300/china%E2%80%99s-bgi-says-it-can-sequence-a-genome-for-just-100</link>
	<title><![CDATA[China’s BGI says it can sequence a genome for just $100]]></title>
	<description><![CDATA[<p>Using technology originally acquired in the US, the Chinese gene giant BGI Group says it will make genome sequencing cheaper than ever, breaking the $100 barrier for the first time.</p><p>The Shenzhen company says the low cost will be possible with an &ldquo;extreme&rdquo; DNA sequencing system it plans to offer that is capable of decoding the genomes of 100,000 people a year.</p><p>Ref:&nbsp;<a href="https://www.technologyreview.com/s/615289/china-bgi-100-dollar-genome/">https://www.technologyreview.com/s/615289/china-bgi-100-dollar-genome/</a></p>]]></description>
	<dc:creator>Neel</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/41592/refka-a-fast-and-efficient-long-read-genome-assembly-approach-for-large-and-complex-genomes</guid>
	<pubDate>Fri, 01 May 2020 03:00:40 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/41592/refka-a-fast-and-efficient-long-read-genome-assembly-approach-for-large-and-complex-genomes</link>
	<title><![CDATA[RefKA: A fast and efficient long-read genome assembly approach for large and complex genomes]]></title>
	<description><![CDATA[<p><span>RefKA, a reference-based approach for long read genome assembly. This approach relies on breaking up a closely related reference genome into bins, aligning k-mers unique to each bin with PacBio reads, and then assembling each bin in parallel followed by a final bin-stitching step.</span></p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="https://github.com/AppliedBioinformatics/RefKA" rel="nofollow">https://github.com/AppliedBioinformatics/RefKA</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

</channel>
</rss>