More at https://boards.greenhouse.io/twistbioscience/jobs/3135495?gh_src=9ecc0b941us

Address of the bookmark: http://www.ogt.com/assets/0000/3190/NGS_Survey_2013_Infographic_Web.pdf

Read more: https://edu.t-bio.info/amity-university-summer-bioinformatics-program-registrations-are-open/

Welcome to phylobabble.org, a discussion forum for phylogenetic theory and applications. The primary goal of this forum is to discuss best practice and new developments in phylogenetics. Although we do have a Troubleshooting category for getting feedback on analyses, this is not a help site for running phylogenetics programs.

A great place to chat about phylogenetics for researchers and the broader community of students and science-interested citizens. 

Address of the bookmark: http://phylobabble.org/

Can't locate XML/parser.pm in @INC (@INC contains:
/usr/lib/perl5/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/5.10.0
/usr/local/lib/perl5/site_perl/5.10.0/i386-linux-thread-multi
/usr/local/lib/perl5/site_perl/5.10.0
/usr/lib/perl5/vendor_perl/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.10.0 /usr/lib/perl5/vendor_perl
/usr/lib/perl5/site_perl/5.10.0 .)

Manual Method of Perl Module Installation

• Install Perl Modules Manually

This manual method is very useful when your computer or server is not connected to the Internet.

Download Perl module:
Go to CPAN Search website and search for the module that you wish to download. In this example, let us search, download and install XML::Parser Perl module. I have downloaded the XML-Parser-2.36.tar.gz to /home/download

# cd /home/download
# gzip -d XML-Parser-2.36.tar.gz
# tar xvf XML-Parser-2.36.tar
# cd XML-Parser-2.36

Build the perl module:
Build by running Makefile.PL, remember the case sensitivity, make and make test.

# perl Makefile.PL
Checking if your kit is complete...
Looks good
Writing Makefile for XML::Parser::Expat
Writing Makefile for XML::Parser
# make
# make test

Install the perl module:
Now your package is ready to install.

# make install

As a newbie it looks pretty simple, and one go. But, luckily this is a very simple one module with no dependencies. Typically, Perl modules will be dependent on several other modules. Just imagine chasing all these dependencies one-by-one, thinking ... oh ye I got it. That will be very painful and annoying task. I recommend the CPAN method of installation as shown below.

Install Perl Modules using CPAN automatically

Logically, you should must have the CPAN perl module installed in your server or computer before you can install any other Perl modules using CPAN. I know you  are laughing, "to install a perl module you need another perl module"  ;)

Lets verify whether CPAN is already installed:

To install Perl modules using CPAN, make sure the cpan command is working. Following are the error message when CPAN module is not installed.

# cpan
-bash: cpan: command not found

# perl -MCPAN -e shell
Can't locate CPAN.pm in @INC (@INC contains:
/usr/lib/perl5/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/5.10.0
/usr/local/lib/perl5/site_perl/5.10.0/i386-linux-thread-multi
/usr/local/lib/perl5/site_perl/5.10.0
/usr/lib/perl5/vendor_perl/5.10.0/i386-linux-thread-multi
/usr/lib/perl5/vendor_perl/5.10.0
/usr/lib/perl5/vendor_perl /usr/lib/perl5/site_perl/5.10.0 .).
BEGIN failed--compilation aborted.

Install the CPAN module using yum:
If CPAN in not installed in your system, you can use "yum" for the rescue. Dont worry biological data cruncher, this is true we are now dependent all these tiny magicians :).

# yum install perl-CPAN

Output of yum install perl-CPAN command:

Loaded plugins: refresh-packagekit
updates-newkey                       | 2.3 kB     00:00
primary.sqlite.bz2                   | 2.4 MB     00:00
Setting up Install Process
Parsing package install arguments

Resolving Dependencies
Transaction Summary
=============================================================================
Install      5 Package(s)
Update       0 Package(s)
Remove       0 Package(s)

Total download size: 1.0 M
Is this ok [y/N]: y
Downloading Packages:
(1/5): perl-ExtUtils-ParseXS-2.18-31.fc9.i386.rpm     |  30 kB     00:00
(2/5): perl-Test-Harness-2.64-31.fc9.i386.rpm         |  70 kB     00:00
(3/5): perl-CPAN-1.9205-31.fc9.i386.rpm               | 217 kB     00:00
(4/5): perl-ExtUtils-MakeMaker-6.36-31.fc9.i386.rpm   | 284 kB     00:00
(5/5): perl-devel-5.10.0-31.fc9.i386.rpm              | 408 kB     00:00

Installing     : perl-ExtUtils-ParseXS                             [1/5]
Installing     : perl-devel                                        [2/5]
Installing     : perl-Test-Harness                                 [3/5]
Installing     : perl-ExtUtils-MakeMaker                           [4/5]
Installing     : perl-CPAN                                         [5/5]


Installed: perl-CPAN.i386 0:1.9205-31.fc9
Dependency Installed:
  perl-ExtUtils-MakeMaker.i386 0:6.36-31.fc9
  perl-ExtUtils-ParseXS.i386 1:2.18-31.fc9
  perl-Test-Harness.i386 0:2.64-31.fc9
  perl-devel.i386 4:5.10.0-31.fc9
Complete!

Configure cpan the first time:
Once the CPAN is installed, you need to configure it by executing cpan, you should set some configuration parameters as shown below. I have shown only the important configuration parameters below. Accept all the default values by pressing enter.

Note: Make sure to execute “o conf commit” in the cpan prompt after the configuration to save the settings.

# cpan

Sorry, we have to rerun the configuration dialog for CPAN.pm due
to some missing parameters...

CPAN build and cache directory? [/root/.cpan]
Download target directory? [/root/.cpan/sources]
Directory where the build process takes place? [/root/.cpan/build]

Always commit changes to config variables to disk? [no]
Cache size for build directory (in MB)? [100]
Let the index expire after how many days? [1]

Perform cache scanning (atstart or never)? [atstart]
Cache metadata (yes/no)? [yes]
Policy on building prerequisites (follow, ask or ignore)? [ask]

Parameters for the 'perl Makefile.PL' command? []
Parameters for the 'perl Build.PL' command? []

Your ftp_proxy? []
Your http_proxy? []
Your no_proxy? []
Is it OK to try to connect to the Internet? [yes]

First, pick a nearby continent and country by typing in the number(s)
(1) Africa
(2) Asia
(3) Central America
(4) Europe
(5) North America
(6) Oceania
(7) South America
Select your continent (or several nearby continents) [] 5

(1) Bahamas
(2) Canada
(3) Mexico
(4) United States
Select your country (or several nearby countries) [] 4

(2) ftp://carroll.cac.psu.edu/pub/CPAN/
(3) ftp://cpan-du.viaverio.com/pub/CPAN/
(4) ftp://cpan-sj.viaverio.com/pub/CPAN/
(5) ftp://cpan.calvin.edu/pub/CPAN
(6) ftp://cpan.cs.utah.edu/pub/CPAN/
e.g. '1 4 5' or '7 1-4 8' [] 2-16

cpan[1]> o conf commit
commit: wrote '/usr/lib/perl5/5.10.0/CPAN/Config.pm'

cpan[2]> quit
No history written (no histfile specified).
Lockfile removed.

• Install Perl Modules using CPAN

Hey smile please, now you are ready with CPAN and can download modules in one line command.

You can use one of the following method to install a Perl module using cpan:

# perl -MCPAN -e 'install Bundle::BioPerl'

(or)

# cpan
cpan shell -- CPAN exploration and modules installation (v1.9205)
ReadLine support available (maybe install Bundle::CPAN or Bundle::CPANxxl?)

cpan[1]> install "Bundle::BioPerl"

In the example above, CPAN will check for Bundle::BioPerl dependencies and automatically resolves and installs Bundle::BioPerl with all the dependent Perl modules.

• Quick Ways

Oh, look at your face.. smily hmm :). This is what your are looking for, a quick and best way to install Perl modules, Bioperl. Following are the the steps to download BioPerl in your server/computer.

# sudo apt-cache search perl BioPerl

Output will be like as follows:

bioperl - Perl tools for computational molecular biology
bioperl-run - BioPerl wrappers: scripts
libbio-perl-perl - BioPerl core perl modules
libbio-perl-run-perl - BioPerl wrappers: modules
libbio-samtools-perl - Perl interface to SamTools library for DNA sequencing
libbiojava-java - Java API to biological data and applications (default version)
libbiojava3-java - Java API to biological data and applications (default version)
python-biopython-sql - Biopython support for the BioSQL database schema
libbtlib-perl - library for basic sequence manipulation

# sudo apt-get install bioperl

If it is installed then flash the following message:

Reading package lists... Done
Building dependency tree      
Reading state information... Done
bioperl is already the newest version.
0 upgraded, 0 newly installed, 0 to remove and 10 not upgraded.

In it is found not installed in your server or system them install all with dependencies.

You can use the same approach to install all the modules, and packages if required.

Thanks for reading. Best of luck for your research.

Scientists with a long-running Framingham Heart Study looked at 1,932 people (examination of about 1.5 million markers of genetic variations), comparing unrelated friends to unrelated strangers. They found that friends shared about 1% of their genes — a percentage much higher than those shared with strangers.This new findings made it clear that people have more DNA in common with those who are selected as friends than with strangers in the same population. 

The genes that lined up the most were olfactory genes, which deal with smell. The ones that lined up the least were immune system genes. The researchers weren't sure why that happened :/. Olfactory genes might be a straightforward explanation: People who like the same smells tend to be drawn to similar environments, where they meet others with the same tendencies.

Reference:

http://www.pnas.org/content/111/Supplement_3/10796.full

Image : http://i.kinja-img.com

01. Scientist II 01
Essential: Ph.D. degree in Life Sciences from a recognized university along with a minimum of 2 years of research experience in Bioinformatics as evidenced by publications in the peer reviewed journals.

OR
Ph.D. degree in Bioinformatics from a recognized university.

OR
M.Sc. in Bioinformatics from a recognized university along with a minimum of 3 years of research experience in Bioinformatics as evidenced by publications in the peer reviewed journals.

Desirable:
Thorough Knowledge about In silico genome analysis and comparative genomics.
Experience with in silico identification of novel virulence factors of pathogens, host-pathogen interactions and Systems Biology.
Additional Postdoctoral research experience in relevant subjects from a recognized institutions.

Rs. 44,000/- p.m. (consolidated) plus 30% HRA

Below 40 years

Applications along with Bio-Data containing detail work experience and full list of publications may be sent via email tosantasabujdas@yahoo.com latest by October 27, 2014.

Short-listed candidates will be called via email for an interview to be held at the institute in the second week of November, 2014.

Advertisement: www.niced.org.in/placements.htm

For example ... contig-stats.pl is a Perl script that will automatically describe features of a sequence assembly.

http://milkweedgenome.org/?q=scripts

Address of the bookmark: http://milkweedgenome.org/?q=scripts

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}