<?xml version='1.0'?><rss version="2.0" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:georss="http://www.georss.org/georss" xmlns:atom="http://www.w3.org/2005/Atom" >
<channel>
	<title><![CDATA[BOL: Related items]]></title>
	<link>https://bioinformaticsonline.com/related/396?offset=20</link>
	<atom:link href="https://bioinformaticsonline.com/related/396?offset=20" rel="self" type="application/rss+xml" />
	<description><![CDATA[]]></description>
	
	<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</guid>
	<pubDate>Sun, 24 May 2015 09:28:33 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22388/perl-one-liner-basics</link>
	<title><![CDATA[Perl One liner basics !!]]></title>
	<description><![CDATA[<p>Perl has a ton of command line switches (see perldoc perlrun), but I'm just going to cover the ones you'll commonly need to debug code. The most important switch is -e, for execute (or maybe "engage" :) ). The -e switch takes a quoted string of Perl code and executes it. For example:<br /><br />$ perl -e 'print "Hello, World!\n"'<br />Hello, World!<br /><br />It's important that you use single-quotes to quote the code for -e. This usually means you can't use single-quotes within the one liner code. If you're using Windows cmd.exe or PowerShell, you must use double-quotes instead.<br /><br />I'm always forgetting what Perl's predefined special variables do, and often test them at the command line with a one liner to see what they contain. For instance do you remember what $^O is?<br /><br />$ perl -e 'print "$^O\n"'<br />linux<br /><br />It's the operating system name. With that cleared up, let's see what else we can do. If you're using a relatively new Perl (5.10.0 or higher) you can use the -E switch instead of -e. This turns on some of Perl's newer features, like say, which prints a string and appends a newline to it. This saves typing and makes the code cleaner:<br /><br />$ perl -E 'say "$^O"'<br />linux<br /><br />Pretty handy! say is a nifty feature that you'll use again and again.</p>]]></description>
	<dc:creator>Abhimanyu Singh</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</guid>
	<pubDate>Tue, 09 Jun 2015 23:38:44 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22570/frequent-words-problem-solution-by-perl</link>
	<title><![CDATA[Frequent words problem solution by Perl]]></title>
	<description><![CDATA[<div><p>Solved with perl <a href="http://rosalind.info/problems/1a/">http://rosalind.info/problems/1a/</a></p><p>#Find the most frequent k-mers in a string.<br />#Given: A DNA string Text and an integer k.<br />#Return: All most frequent k-mers in Text (in any order).<br /><br />use strict;<br />use warnings;<br /><br />my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";<br />my $kmer=4; <br />my %myHash;<br />my $max=0;<br /><br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myStr=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;#print "$myStr\n";<br />&nbsp;&nbsp; &nbsp;my $km=kmerMatch ($string, $myStr, $kmer);<br />&nbsp;&nbsp; &nbsp;if ($km &gt; $max) { $max = $km;}<br />&nbsp;&nbsp; &nbsp;#print "$km\t$myStr\n";<br />&nbsp;&nbsp; &nbsp;$myHash{$myStr}=$km;<br />&nbsp;&nbsp; &nbsp;<br />}<br /><br />#Print all key which have matching values<br />foreach my $name (keys %myHash){<br />&nbsp;&nbsp;&nbsp; print "$name " if $myHash{$name} == $max;<br />}<br /><br />sub kmerMatch { #Check the exact matching kmers with sliding window<br />my ($string, $myStr, $kmer)=@_;<br />my $count=0;<br />for (my $aa=0; $aa&lt;=(length($string)-4); $aa++) {<br />&nbsp;&nbsp; &nbsp;my $myWin=substr&nbsp; $string, $aa,$kmer;<br />&nbsp;&nbsp; &nbsp;if ($myWin eq $myStr) {<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;#print "$myWin eq $myStr\n";<br />&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp;$count++;<br />&nbsp;&nbsp; &nbsp;}<br />}<br />return $count;<br />}</p></div>]]></description>
	<dc:creator>Jit</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</guid>
	<pubDate>Wed, 10 Jun 2015 00:17:17 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/22572/clump-finding-problem-solved-with-perl</link>
	<title><![CDATA[Clump Finding Problem Solved with Perl]]></title>
	<description><![CDATA[<p>The question at http://rosalind.info/problems/1d/</p><p>Script are moved to&nbsp;http://bioinformaticsonline.com/snippets/view/34633/clump-finding-problem-solved-with-perl</p>]]></description>
	<dc:creator>Jit</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/26627/scientist-computational-genomics-two-positions</guid>
  <pubDate>Sat, 12 Mar 2016 18:07:56 -0600</pubDate>
  <link></link>
  <title><![CDATA[Scientist - Computational Genomics (Two Positions)]]></title>
  <description><![CDATA[
<p>ICRISAT is a non-profit, non-political organization that conducts agricultural research for development in Asia and sub-Saharan Africa with a wide array of partners throughout the world. Covering 6.5 million square kilometers of land in 55 countries, the semi-arid tropics is home to over 2 billion people, with 650 million of these being the poorest of the poor. ICRISAT and its partners help empower those living in the semi-arid tropics, especially smallholder farmers, to overcome poverty, hunger, malnutrition and a degraded environment through more efficient and profitable agriculture.</p>

<p>ICRISAT is headquartered in Patancheru near Hyderabad, India, with two regional hubs and five country offices in sub-Saharan Africa. ICRISAT, established in 1972, is a member of the CGIAR Consortium. For more details, see www.icrisat.org.</p>

<p>Responsibilities:Design efficient SQL queries for pulling large sequencing projects.<br />Serve as a technical adviser to the project leadership and provide computational perspective on product design and deliverability.<br />Develop and oversee a rapid and incremental software development and release schedule.<br />Design the software architecture, oversee the implementation and evolution of the design on appropriate hardware platforms.<br />Working collaboratively in a team environment to design, code, test, debug, and document programs for an integrated genomic analysis pipeline in a rapid and incremental software development and release schedule.<br />Supervise and review code development and ensure that software products meet project objectives in terms of functionality, scalability, robustness and user experience.<br />Implement and oversee the QA/QC practices to ensure the development team is adhering to quality standards.<br />Work closely with the application specialist to integrate feedbacks from teams in each CGIAR center into software customization and improvement.<br />Assist in training of breeders in the CGIAR centers to use software developed.<br /> Personal Profile:</p>

<p>The applicant should have:</p>

<p>Understanding of genomics data and advanced knowledge of Java, and C/C++ as the programming languages and any of the scripting language like perl and/or Python, SQL<br />High Performance Computing, data architecture, database platforms and QA/QC practices in software engineering.<br />She/he should have solid experience in software development projects, preferably as a senior programmer or in the software project management role, and in projects involving big data.<br />Excellent communication skills are needed to work in this multi-disciplinary, multi-location and multi-cultural team.<br />Ability to mentor colleagues in quality software development practices is desired.<br />Educational Qualification : Ph. D or Masters Degree in Computational Biology / Computational Genomics or Equivalent with Research Experience in Mentioned Areas.</p>

<p>More at http://www.icrisat.org/careers/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/pages/view/37590/parallel-processing-with-perl</guid>
	<pubDate>Sat, 25 Aug 2018 11:32:40 -0500</pubDate>
	<link>https://bioinformaticsonline.com/pages/view/37590/parallel-processing-with-perl</link>
	<title><![CDATA[Parallel Processing with Perl !]]></title>
	<description><![CDATA[<p>Here is a small tutorial on how to make best use of multiple processors for bioinformatics analysis. One best way is using perl threads and forks. Knowing how these threads and forks work is very important before implementing them. Getting to know how these work would be really useful before reading this tutorial.</p><p>Many times in bioinformatics we need to deal with huge datasets which&nbsp; are more than 100GB size. The traditional way to analysis a file is using the while loop</p><p>while (FILE){</p><p>Do something;</p><p>}</p><p>This is very slow(since we are using only one processor) and if we have 500 million lines in the dataset it takes more than a day to iterate through the whole dataset. So how do we make best use of all our processors and get the work done quickly?</p><p>Here is a very simple and efficient technique with perl which i have been using. I am&nbsp; more inclined towards using perl fork than perl threads.</p><p>One of the oldest way to fork is</p><blockquote><p>my $fork = fork();<br />if($fork){&nbsp;&nbsp;&nbsp;<br />push (@childs,$fork);&nbsp;<br />}<br />elseif($fork==0){<br /><strong>your code here;</strong><br />exit(0);<br />}<br />else{die &ldquo;Couldnt fork : $!&rdquo;;}</p><p>## wait for the child process to finish<br />foreach(@childs){<br />my $tmp=waitid($_,0);<br />}</p></blockquote><p>what a fork does is it creates a child process and takes the variables and code with it to analyze it separately (detached from the parent process) and thus a separate process is created( which usually runs on a separate processor). Thats it!! One big disadvantage of forking is its very difficult to share variables among the different processes. I will show you how to do it easily but still it has its own drawbacks.</p><blockquote><p>Okie, now if you really do not want to use fork in your code, that&rsquo;s okie too..There are many useful modules which do it for you very efficiently. One really useful module is Parallel::ForkManager. You can use Parallel::ForkManager to manage the number of forks you want to generate (number of processors you want to use).</p><p><strong>Simple usage:</strong><br />use Parallel::ForkManager;<br />my $max_processors=8;<br />my $fork= new Parallel::ForkManager($max_processors);<br />foreach (@dna) {<br />$fork-&gt;start and next; # do the fork<br /><strong>you code here;</strong><br />$fork-&gt;finish; # do the exit in the child process<br />}<br />$pm-&gt;wait_all_children;</p></blockquote><p>so you will be generating 8 forks which do the same thing for your each element of array. when one child finishes, Parallel::ForkManager generates a new one and thus you will be using all your processors to analyze the data. Now, if you have generated 8 child processes and want to write the data to one file. You need to lock the file to do this, because you will have problems with the buffering. You can lock the file using flock command.</p><blockquote><p>open (my $QUAL, &ldquo;myfile.txt&rdquo;);<br />flock $QUAL, LOCK_EX or die &ldquo;cant lock file $!&rdquo;;<br />print $QUAL &ldquo;$output&rdquo;;<br />flock $QUAL, LOCK_UN or die &ldquo;$!&rdquo;;<br />close $QUAL;</p></blockquote><p>I would not suggest using flock when dealing with multiple processes because it will decrease the processing efficiency( each child process must wait for the lock to be released by the other child process). Instead, I would suggest each fork writing to a separate file and after the processing just concatenating them.</p><p><strong>Putting it all together, If you have 100GB data you can do this</strong></p><blockquote><p><strong>step 1</strong>&nbsp;: split the dataset equally according to number of processors you have. this may take a few hours(about 2-3 hrs for 100GB file)<br />You can use unix &ldquo;split&rdquo; command for this<br />for example:<br />my $number_split=int($number_of_entries_in_your_dataset/$max_processors);<br />my $split_Files=`split -l $number_split &ldquo;your_file.fasta&rdquo; &ldquo;file_name&rdquo;`;</p><p><strong>step2</strong>: open you directory comtaining you split files and start Parallel::ForkManager.<br /><strong>For example:</strong><br />opendir(DIRECTORY, $split_files_directory) or die $!; ### open the directory<br />my $fork= new Parallel::ForkManager($max_processors);<br />while (my $file = readdir(DIRECTORY)) { ### read the directory<br />if($file=~/^\./){next;}<br />print $file,&rdquo;\n&rdquo;;<br />########## Start fork ##########<br />my $pid= $super_fork-&gt;start and next;<br /><strong>Whatever you want to do with the split file ;</strong><br /><strong>analyze my piece of $file;</strong><br />######### end fork ###############<br />$super_fork-&gt;finish;<br />}<br />$super_fork-&gt;wait_all_children;</p></blockquote><p>So basically each processor will be active with its piece of data (split file) and thus you have created 8 processes at one time which run without interfering with the other process. I again will not suggest writing output from each child process to one file(for reasons above). Write output from each fork to a separate file and finally concatenate them. Thats it, you have just increased your program speed by 8 times!! Isnt it easy?</p><p><strong>Note:</strong><br />You may worry about concatenation of the output each child generates, since it does take some time(remember 100GB). I think now you can use a mysql database LOAD DATA LOCAL INFILE command to load all the files into a single table(Should take about 3hrs for 100Gb dataset) and then export the whole table into one file. This should be faster than just concatenating them using &ldquo;cat&rdquo; command.(correct me if I am wrong)</p><p>Or much simpler way is to use pipes</p><p>cat output_dir/* | my_pipe or my_pipe &lt;(file1) final_file;</p><p>Thats it guys!! Enjoy programming and please do comment. I am not a computer scientist so forgive me for any mistakes and if any please report them. Thank you.</p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>

<item>
  <guid isPermaLink='true'>https://bioinformaticsonline.com/opportunity/view/41905/research-associate-bioinformatics-in-iisc-recruitment-2020</guid>
  <pubDate>Tue, 23 Jun 2020 21:53:34 -0500</pubDate>
  <link></link>
  <title><![CDATA[Research Associate Bioinformatics in IISc Recruitment 2020]]></title>
  <description><![CDATA[
<p>Research Associate Bioinformatics in IISc Recruitment 2020</p>

<p>Essential Qualifications: Ph.D. (Bioinformatics/ Biophysics/ Biotechnology or any other stream of biological/ physical sciences) with a minimum of two publications in reputed peer reviewed journals in the area of structural bioinformatics or biophysics or biomolecular modeling/ simulation.</p>

<p>Job description: Development of bioinformatics tools and algorithms/software for structure based analysis of biomolecular systems. Programmatic access to major biomolecular databases using APIs Knowledge based prediction and analysis of biomolecular structure, function and interactions. Docking/simulations for inhibitor design.</p>

<p>Desirable Qualifications (Research Associate/s): i)  Strong computer programming skills (in Python/PERL/PHP or C++ or object oriented database management systems like MySQL etc or scripting languages under LINUX/UNIX environment). </p>

<p>ii) Extensive experience in computational analysis of biomolecular structure/interactions and usage of advanced biomolecular simulation softwares. iii) Adequate knowledge of major databases, webservers and softwares in the area of biomolecular structure/function and drug design. iv)  Familiarity with Parallel Programming environments and experience in usage of high-end HPC clusters.</p>

<p>The candidates must highlight their experience in above mentioned fields/topics in their CV. Initial appointment will be for a period of 1 year, subject to extension after review of performance.</p>

<p>Emoluments: As per DST, GOI norms and commensurate with experience.</p>

<p>More at https://www.iisc.ac.in/positions-open/</p>
]]></description>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/4042/a-brief-introduction-to-genetics</guid>
	<pubDate>Wed, 28 Aug 2013 06:49:38 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/4042/a-brief-introduction-to-genetics</link>
	<title><![CDATA[A Brief Introduction to Genetics]]></title>
	<description><![CDATA[<iframe src="http://player.vimeo.com/video/20898800?byline=0" width="" height="" frameborder="0" webkitAllowFullScreen allowFullScreen></iframe>A Brief Introduction to Genetics is a short documentary film that explores the history of genetics & genomics and the underlying concepts that provide the foundational knowledge that today's research is built upon. The film describes the history of genetics, from Gregor Mendel, to concepts such as DNA and the genetic code. Having introduced the fundamental ideas of genetics, the film moves on to describe the current techniques used to study genetics. Finally, the film explores the connection of these core concepts to genomics and bioinformatics.]]></description>
	
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/4037/perl-and-bioperl-tutorials</guid>
	<pubDate>Wed, 28 Aug 2013 05:51:38 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/4037/perl-and-bioperl-tutorials</link>
	<title><![CDATA[Perl and BioPerl Tutorials]]></title>
	<description><![CDATA[<p>This bookmark is created to store the useful Perl and BioPerl tutorial links at one place. Feel free to share and add more useful tutorial links here ....&nbsp;</p>
<p>&nbsp;</p><p>Address of the bookmark: <a href="http://cbb.sjtu.edu.cn/course/database/beginning.pdf" rel="nofollow">http://cbb.sjtu.edu.cn/course/database/beginning.pdf</a></p>]]></description>
	<dc:creator>Jitendra Narayan</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/bookmarks/view/37509/vcftools-perform-common-tasks-with-vcf-files-such-as-file-validation-file-merging-intersecting-complements</guid>
	<pubDate>Tue, 07 Aug 2018 10:01:46 -0500</pubDate>
	<link>https://bioinformaticsonline.com/bookmarks/view/37509/vcftools-perform-common-tasks-with-vcf-files-such-as-file-validation-file-merging-intersecting-complements</link>
	<title><![CDATA[VCFtools: perform common tasks with VCF files such as file validation, file merging, intersecting, complements]]></title>
	<description><![CDATA[<p>VCFtools contains a Perl API (<a href="http://vcftools.sourceforge.net/perl_module.html#Vcf.pm">Vcf.pm</a>) and a number of Perl scripts that can be used to perform common tasks with VCF files such as file validation, file merging, intersecting, complements, etc. The Perl tools support all versions of the VCF specification (3.2, 3.3, 4.0, 4.1 and 4.2), nevertheless, the users are encouraged to use the latest versions VCFv4.1 or VCFv4.2. The VCFtools in general have been used mainly with diploid data, but the Perl tools aim to support polyploid data as well. Run any of the Perl scripts with the&nbsp;<strong>--help</strong>&nbsp;switch to obtain more help.</p>
<p>Many of the&nbsp;<strong>Perl scripts require that the VCF files are compressed by&nbsp;<span>bgzip</span>&nbsp;and indexed by&nbsp;<span>tabix</span></strong>&nbsp;(both tools are part of the tabix package, available for&nbsp;<a href="https://sourceforge.net/projects/samtools/files/tabix/">download here</a>). The VCF files can be compressed and indexed using the following commands</p>
<p>bgzip my_file.vcf<br>tabix -p vcf my_file.vcf.gz</p>
<p>&nbsp;</p>
<p>http://vcftools.sourceforge.net/perl_module.html</p><p>Address of the bookmark: <a href="http://vcftools.sourceforge.net/perl_module.html" rel="nofollow">http://vcftools.sourceforge.net/perl_module.html</a></p>]]></description>
	<dc:creator>Rahul Nayak</dc:creator>
</item>
<item>
	<guid isPermaLink="true">https://bioinformaticsonline.com/videolist/watch/13267/the-genome-10k-project</guid>
	<pubDate>Tue, 29 Jul 2014 09:11:04 -0500</pubDate>
	<link>https://bioinformaticsonline.com/videolist/watch/13267/the-genome-10k-project</link>
	<title><![CDATA[The Genome 10K Project]]></title>
	<description><![CDATA[<iframe width="" height="" src="https://www.youtube-nocookie.com/embed/B57xDIGtCT0" frameborder="0" allowfullscreen></iframe>https://genome10k.soe.ucsc.edu

The Genome 10K project aims to assemble a genomic zoo—a collection of DNA sequences representing the genomes of 10,000 vertebrate species, approximately one for every vertebrate genus. The trajectory of cost reduction in DNA sequencing suggests that this project will be feasible within a few years. Capturing the genetic diversity of vertebrate species would create an unprecedented resource for the life sciences and for worldwide conservation efforts.

The growing Genome 10K Community of Scientists (G10KCOS), made up of leading scientists representing major zoos, museums, research centers, and universities around the world, is dedicated to coordinating efforts in tissue specimen collection that will lay the groundwork for a large-scale sequencing and analysis project.]]></description>
	
</item>

</channel>
</rss>