Qualifications

PhD or Post-Graduated Master degree is required. Successful candidates will have some expertise in data analysis of NGS data by using methods running in R and UNIX environment. Familiarity with genome databases and browsers is required.

Application

Candidates should send a CV and a brief personal statement focusing on their skills and interests related to the research project.

Contacts

Start date: 1° April 2014
Salary on grant: 25,000 euros per year.
Contact Person (Referent): Mario Capasso
Ref. Email: mario.capasso@unina.it and achille.iolascon@unina.it
Tel: +39 081 3737889

awk '/pattern1/ {Actions}
/pattern2/ {Actions}' file

The working of Awk is as follows
Awk reads the input files one line at a time.
For each line, it matches with given pattern in the given order, if matches performs the corresponding action.
If no pattern matches, no action will be performed.
In the above syntax, either search pattern or action are optional, But not both.
If the search pattern is not given, then Awk performs the given actions for each line of the input.
If the action is not given, print all that lines that matches with the given patterns which is the default action.
Empty braces with out any action does nothing. It wont perform default printing operation.
Each statement in Actions should be delimited by semicolon.
Say you have data.tsv with the following contents:

$ cat data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
By default Awk prints every line from the file.

$ awk '{print;}' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
We print the line which matches the pattern contig3

$ awk '/contig3/' data/test.tsv
contig3 ACTTATATATATATA
Awk has number of builtin variables. For each record i.e line, it splits the record delimited by whitespace character by default and stores it in the $n variables. If the line has 5 words, it will be stored in $1, $2, $3, $4 and $5. $0 represents the whole line. NF is a builtin variable which represents the total number of fields in a record.

$ awk '{print $1","$2;}' data/test.tsv
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT

$ awk '{print $1","$NF;}' data/test.tsv
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT

Awk has two important patterns which are specified by the keyword called BEGIN and END. The syntax is as follows:

BEGIN { Actions before reading the file}
{Actions for everyline in the file}
END { Actions after reading the file }

For example,
$ awk 'BEGIN{print "Header,Sequence"}{print $1","$2;}END{print "-------"}' data/test.tsv
Header,Sequence
contig1,ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2,ACTTTATATATT
contig3,ACTTATATATATATA
contig4,ACTTATATATATATA
contig5,ACTTTATATATT
-------
We can also use the concept of a conditional operator in print statement of the form print CONDITION ? PRINT_IF_TRUE_TEXT : PRINT_IF_FALSE_TEXT. For example, in the code below, we identify sequences with lengths > 14:

$ awk '{print (length($2)>14) ? $0">14" : $0"<=14";}' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG>14
contig2 ACTTTATATATT<=14
contig3 ACTTATATATATATA>14
contig4 ACTTATATATATATA>14
contig5 ACTTTATATATT<=14
We can also use 1 after the last block {} to print everything (1 is a shorthand notation for {print $0} which becomes {print} as without any argument print will print $0 by default), and within this block, we can change $0, for example to assign the first field to $0 for third line (NR==3), we can use:

$ awk 'NR==3{$0=$1}1' data/test.tsv
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
You can have as many blocks as you want and they will be executed on each line in the order they appear, for example, if we want to print $1 three times (here we are using printf instead of print as the former doesn't put end-of-line character),

$ awk '{printf $1"\t"}{printf $1"\t"}{print $1}' data/test.tsv
contig1 contig1 contig1
contig2 contig2 contig2
contig3 contig3 contig3
contig4 contig4 contig4
contig5 contig5 contig5
Although, we can also skip executing later blocks for a given line by using next keyword:

$ awk '{printf $1"\t"}NR==3{print "";next}{print $1}' data/test.tsv
contig1 contig1
contig2 contig2
contig3
contig4 contig4
contig5 contig5

$ awk 'NR==3{print "";next}{printf $1"\t"}{print $1}' data/test.tsv
contig1 contig1
contig2 contig2

contig4 contig4
contig5 contig5
You can also use getline to load the contents of another file in addition to the one you are reading, for example, in the statement given below, the while loop will load each line from test.tsv into k until no more lines are to be read:

$ awk 'BEGIN{while((getline k <"data/test.tsv")>0) print "BEGIN:"k}{print}' data/test.tsv
BEGIN:contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
BEGIN:contig2 ACTTTATATATT
BEGIN:contig3 ACTTATATATATATA
BEGIN:contig4 ACTTATATATATATA
BEGIN:contig5 ACTTTATATATT
contig1 ACTGTCTGTCACTGTGTTGTGATGTTGTGTGTG
contig2 ACTTTATATATT
contig3 ACTTATATATATATA
contig4 ACTTATATATATATA
contig5 ACTTTATATATT
You can also store data in the memory with the syntax VARIABLE_NAME[KEY]=VALUE which you can later use through for (INDEX in VARIABLE_NAME) command:

$ awk '{i[$1]=1}END{for (j in i) print j"<="i[j]}' data/test.tsv
contig1<=1
contig2<=1
contig3<=1
contig4<=1
contig5<=1

If you have a license key for Modeller 8 or 9, there is no need to reregister for Modeller 9.13 - the same license key will work. (It won't do any harm to reregister if you want to, though!)

9.13 is primarily a bugfix release relative to the last public release(9.12). Major user-visible changes include:

# Modeller now includes a variety of SOAP (statistically optimized atomic potential) scores for assessing proteins, loops, and interfaces.

# The Lennard-Jones interaction energy is now artificially truncated at very short distance; this makes simulations with poor starting conditions much less likely to 'blow up'.

# model.get_insertions(), model.get_deletions() and model.loops() now have an include_termini option; if False, residue ranges that include chain termini are excluded from the output.

See the Modeller manual for a full change log: http://salilab.org/modeller/9.13/manual/node39.html

If you encounter bugs in Modeller 9.13, please see http://salilab.org/modeller/9.13/manual/node10.html for information on how to report them.

Reference:

http://salilab.org/modeller/

https://edu.t-bio.info/collaborative-model-bioinformatics-education-combining-biologically-inspired-bioinformatics-project-based-learning/

Bioinformatician are not anti-social; We are just genome friendly.

Bioinformatician would love to change the biological world, but they won't give us the genetic code :P

If at first you don't succeed; call it version 1.0

The glass is neither half-full nor half-empty: it's actually have several genomes.

I'm BioGeek.

Fedup with LIPS, try God script.

Idiot, Go ahead, make my data!

Thank god, my genome just compiled.

Error message: "Out of space on genome drive:"

Shut up mobile elements, or i'll flush you out.

Never underestimate the internet bandwidth, u gotta incomplete.

Applied fuzzy logic to understand God's logic?

Warning! Overflow, delete chromosome !

Be nice to the BioGeek, for all you know they might be the next curator!

Beware of computational biologist they screw genes and protein.

Warning! Your genome is full of garbage, delete it !

Bad or missing mouse genome. Spank the cat? (Y/N)

Genome make very fast, very accurate mistakes.

Let's BLAST it.

Some genome never has transposons. It just develops random features.

Go watch CINEMA and have BLAST.

1. Update new things continuously
As per my personal experience, it’s not always easy to work as a bioinformatician!  There are couple of reasons to say that; First computational part of biology make our life’s a little harder compared to other professional categories. The fact - for instance - that the technology cycle in the bioinformatics world is very short, the actual knowledge becomes outdated in a few months or years. Therefore, we need to learn continuously - new things get important. Second, to stay on top of things we really need the strong will to be good at our job. That's probably the most important characteristic to bioinformatician. They are usually an excellent knowledge worker with great technical abilities, and have the will to be that over decades!

2. Avoid the sentence "I did not know what to do!"
In our computational biology lab, we generally face lots of technical problems. But as you know, it's impossible to know everything to do the computational biology jobs ( Yup.. because you need diverse and multidisciplinary knowledge to understand biological problems and resolve their respective solutions), therefore it's absolutely necessary that a bioinformatician finds its way through a new topic. How I typically do that is I use google and I talk to other experts in our laboratory or online biostar community to find out what they think. "I did not know what to do!" should not be an argument for us.

3. To make oneself useful
Several time it does happen, you finished our task earlier than expected; in such cases if you have some time left then: Take a coffee and play chess; reversi, etc. In my case I take a rest. Afterwards I think about what I could do that helps the team to achieve its targets, 'cause some of my team mates probably didn't finish! (at least if I didn't met them at coffee bar !!)

4. Care for all
During my rigorous research duration; I attended several workshop organized by my University departments. I had a discussion with other research fellow, professors; I generally ask … what it really takes to make a team successful or to be a successful research leader. They always said: "Well, you need some caring people!" I think there is a lot truth in that statement. If we do not care about quality, timelines, good team culture, respectful communication (!!), clean code, if all this doesn’t matter to us, then I believe the probability is higher that we fail in research and analysis.

5. Be good with people
Because bioinformatician and computational biologist jobs typically involves to work in a (most wanted J cross-departmental!) team, therefore it's important that we're (more or less) good in dealing with other individuals. Everyone have their own strengths and weaknesses, just like us. It's important to treat all the research team mates with respect, regardless of their technical competence or contributions. Of course, sometimes people deserve a clear statement (!!!), but try to do these things one-on-one. Make sure nobody loses his face. Attend the meetings at the coffee bar; be good at table top soccer and go out once in a while to have a beer with your team. You know what I'm talking about.

At the end of a week I look back and I ask myself what I have produced. This could be paperwork, community days or (best!!) programming code. Always remember there is always a solution to a problem. Most of the times there are at least three solutions. So, don’t just blame, suggest a solution.

That's it. I am looking forward to your thoughts and comments!

The bioinforamtics for precision oncology online course provides an opportunity to learn about bioinformatics methods used in precision oncology research and practice. As a subset of precision medicine, precision oncology deals with molecular factors involved in the biological rpocesses that lead to cancer and can help diagnose, treat or prevent this disease. Oncology is driven by data, often times generated using Next Generation Sequencing (NGS) that helps us study the genomic and transcriptomic sub-cellular processes. Learn more and register: https://edu.t-bio.info/bioinformatics-training-precision-oncology/

For knowledge about Linux and their importance amongst bioinformatician plesae read this article "An introduction to Linux for bioinformatics" by Paul Stothard.

Linux cheat sheet at http://bioinformaticsonline.com/file/view/87/linux-cheat-sheet

Please browse for futher useful linux pages on right hand side ...