Address of the bookmark: https://github.com/dthill196/SARS-2-Dashboard-Tutorial

Address of the bookmark: https://github.com/iansealy/coursera-assembly

1. How to perform basic quality checks on the input data
2. How to run a short read assembler on Illumina data
3. How to run a long read assembler on Pacific Biosciences or Oxford Nanopore data
4. How to improve the accuracy of a long read assembly using short reads
5. How to assess the quality of an assembly

https://bioinformaticsdotca.github.io/high-throughput_biology_2017

Address of the bookmark: https://bioinformaticsdotca.github.io/high-throughput_biology_2017_module6_lab

Address of the bookmark: https://training.galaxyproject.org/training-material/topics/assembly/tutorials/unicycler-assembly/tutorial.html

In comparative genome analysis work, we usually compare more than two genomes and looks for syntenic regions amongst them. In my research I used Evolution Highway (RH) http://eh-demo.ncsa.uiuc.edu/, which is a collaborative project designed to provide a visual means for simultaneously comparing genomes of multiple amniote species. The tool removes the burden of manually aligning these maps and allows cognitive skills to be used toward something more valuable than preparation and transformation of data. In addition to EH, attractive Circos (http://circos.ca/) is also very popular for this kind of analysis.

The EH is available online, and can be easily access and use, whereas Circos installation is not entirely straightforward. One of the most difficult parts of the installation involves installing the GD library. Since there weren't good instructions for installing this library on the internet I decided to post instructions here in case they are useful to anyone else.

Following are the steps to install GD modules in Mac OS

1. Setup

Create a folder for the files:

$ mkdir -p /SourceCache
$ cd /SourceCache

Get and unpack the required Jpeg-6b and GD libraries:
Download Jpeg-6b (http://code.google.com/p/google-desktop-for-linux-mirror/downloads/detail?name=jpeg-6b.tar.gz&can=2&q)
Download GD (http://search.cpan.org/~lds/GD-2.46/)

Place the "tar.gz" files in "/SourceCache" and double click to unpack.

2. Install libjpeg

Copy the "config.sub" and "config.guess" files to "/SourceCache". Note that your "config.sub" and ""config.guess" files may be in a slightly different location. The commands below show where they were on my machine:

$ cd /SourceCache/jpeg-6b/src
$ cp /usr/share/libtool/config/config.sub .
$ cp /usr/share/libtool/config/config.guess .

Configure libjpeg as follows. Note that this was installed on a 64 bit machine. However, this method may configure it in a 32 bit format. This may not be the best way to configure the installation but it works.

$ .configure --enable-shared
$ make

Check to see if the following directories exist on your machine. Create the missing directories in the following manner:

$ mkdir -p /usr/local/include
$ mkdir -p /usr/local/bin
$ mkdir -p /usr/local/lib
$ mkdir -p /usr/local/man/man1

Finish making and installing libjpeg:

$ make install

3. Install GD

$ cd /SourceCache/GD-2.46/GD/
$ perl Makefile.PL
$ make
$ make test (optional)
$ make html (optional)
$ make install

Other way for Mac OS
The easiest way to get a lot of these is with a program called Fink, which is similar in nature to the CPAN installer, but installs common GNU utilities. Fink is available from <http://sourceforge.net/projects/fink/>.

Follow the instructions for setting up Fink. Once it's installed, you'll want to run the following as root: fink install gd

It will prompt you for a number of dependencies, type 'y' and hit enter to install all of the dependencies. Then watch it work.

To prevent creating conflicts with the software that Apple installs by default, Fink creates its own directory tree at /sw where it installs most of the software that it installs. This means your libraries and headers for libgd will be at /sw/lib and /sw/include instead of /usr/lib and /usr/local/include. Because of these changed locations for the libraries, the Perl GD module will not install directly via CPAN, because it looks for the specific paths instead of getting them from your environment. But there's a way around that :-)

Instead of typing "install GD" at the cpan> prompt, type look GD. This should go through the motions of downloading the latest version of the GD module, then it will open a shell and drop you into the build directory. Apply below patch to the Makefile.PL file (save the patch into a file and use the command patch < patchfile.)

Then, run these commands to finish the installation of the GD module:

perl Makefile.PL
make
make test
make install
And don't forget to run exit to get back to CPAN.

Install on MS Window, using PPM

C:\Documents and Settings\Owner>ppm
PPM interactive shell (2.2.0) - type 'help' for available commands.
PPM> install GD
Install package 'GD?' (y/N): y
Installing package 'GD'...
Downloading http://ppm.ActiveState.com/PPMPackages/5.6plus/MSW. ...
Installing C:\Perl\site\lib\auto\GD\GD.bs
Installing C:\Perl\site\lib\auto\GD\GD.dll
Installing C:\Perl\site\lib\auto\GD\GD.exp
Installing C:\Perl\site\lib\auto\GD\GD.lib
Installing C:\Perl\html\site\lib\GD.html
Installing C:\Perl\site\lib\GD.pm
Installing C:\Perl\site\lib\qd.pl
Installing C:\Perl\site\lib\auto\GD\autosplit.ix
PPM>


If you can't install it from ppm. You can download it:
http://ppm.ActiveState.com/PPMPackages/5.6plus/MSW.


BTW,All Perl 5.6.1 Modules are located at:

http://ppm.ActiveState.com/PPMPackages/5.6plus/MSW.

Install the Perl GD Module on Linux

$ sudo perl -MCPAN -e shell

Since it was the first time I had run this command on this particular machine I had to answer a lot of questions but simply selected the defaults for everything as this usually works for me. Once in the CPAN shell I entered

$ install Bundle::CPAN

and selected all of the defaults again. Once the CPAN bundle had finished installing I tried to install GD::Graph by typing

$ install GD::Graph

but it failed with hundreds of errors – the first of which was

GD.xs:7:16: error: gd.h: No such file or directory

This was fixed with the following apt-get command (in the bash shell)

$ sudo apt-get install libgd2-xpm-dev

back in the CPAN shell I still couldn’t get GD::Graph to build and I guessed this was because of some left over files from the failed build. I don’t know the command to clean things up inside the CPAN shell and am too lazy to read the docs so I simply went into the .cpan/build directory in my home directory and deleted anything that started with GD – eg

$ rm -rf GD-2.35-HC_vkB

$ rm -rf GDGraph-1.44-Evfibe

and so on. Those strings at the end (VkB and so on) look random so they might be different on your machine. Then I went back into the CPAN shell and ran

$ install GD::Graph

There were a few dependencies which the script fetched and installed for me but everything worked smoothly.

Manual and other Perl Module instalation are mentioned in my previous blog @ http://bioinformaticsonline.com/blog/view/710/how-to-install-perl-modules-manually-using-cpan-command-and-other-quick-ways

Address of the bookmark: http://www.citrusperl.com/

Solved with perl http://rosalind.info/problems/1a/

#Find the most frequent k-mers in a string.
#Given: A DNA string Text and an integer k.
#Return: All most frequent k-mers in Text (in any order).

use strict;
use warnings;

my $string="ACGTTGCATGTCGCATGATGCATGAGAGCT";
my $kmer=4;
my %myHash;
my $max=0;

for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myStr=substr  $string, $aa,$kmer;
    #print "$myStr\n";
    my $km=kmerMatch ($string, $myStr, $kmer);
    if ($km > $max) { $max = $km;}
    #print "$km\t$myStr\n";
    $myHash{$myStr}=$km;
    
}

#Print all key which have matching values
foreach my $name (keys %myHash){
    print "$name " if $myHash{$name} == $max;
}

sub kmerMatch { #Check the exact matching kmers with sliding window
my ($string, $myStr, $kmer)=@_;
my $count=0;
for (my $aa=0; $aa<=(length($string)-4); $aa++) {
    my $myWin=substr  $string, $aa,$kmer;
    if ($myWin eq $myStr) {
        #print "$myWin eq $myStr\n";
        $count++;
    }
}
return $count;
}

ICRISAT is headquartered in Patancheru near Hyderabad, India, with two regional hubs and five country offices in sub-Saharan Africa. ICRISAT, established in 1972, is a member of the CGIAR Consortium. For more details, see www.icrisat.org.

Responsibilities:Design efficient SQL queries for pulling large sequencing projects.
Serve as a technical adviser to the project leadership and provide computational perspective on product design and deliverability.
Develop and oversee a rapid and incremental software development and release schedule.
Design the software architecture, oversee the implementation and evolution of the design on appropriate hardware platforms.
Working collaboratively in a team environment to design, code, test, debug, and document programs for an integrated genomic analysis pipeline in a rapid and incremental software development and release schedule.
Supervise and review code development and ensure that software products meet project objectives in terms of functionality, scalability, robustness and user experience.
Implement and oversee the QA/QC practices to ensure the development team is adhering to quality standards.
Work closely with the application specialist to integrate feedbacks from teams in each CGIAR center into software customization and improvement.
Assist in training of breeders in the CGIAR centers to use software developed.
Personal Profile:

The applicant should have:

Understanding of genomics data and advanced knowledge of Java, and C/C++ as the programming languages and any of the scripting language like perl and/or Python, SQL
High Performance Computing, data architecture, database platforms and QA/QC practices in software engineering.
She/he should have solid experience in software development projects, preferably as a senior programmer or in the software project management role, and in projects involving big data.
Excellent communication skills are needed to work in this multi-disciplinary, multi-location and multi-cultural team.
Ability to mentor colleagues in quality software development practices is desired.
Educational Qualification : Ph. D or Masters Degree in Computational Biology / Computational Genomics or Equivalent with Research Experience in Mentioned Areas.

More at http://www.icrisat.org/careers/