BOL: Related items

Public Databases for Bioinformatics !

Jit — Tue, 23 Mar 2021 05:32:15 -0500

https://www.nature.com/articles/s41467-020-17155-y

Server Infrastructure:

File Server:

dhara: Synology 3614 Storage Appliance
4 Core Xeon
108TB disk storage
10Gb ethernet to SCG3
Access atx: dhara:5000
Has btsync server (try it - its much better than dropbox)

Compute Servers:

nandi: Kundaje and Phi Server
24 intel cores
256GB RAM
500GB of SSD storage 
36TB RAID6 local storage
4 Intel Phi's (space for 4 more GPU's)


durga: Montgomery and sensitive data
24 intel cores
256GB RAM
500GB of SSD RAID0 storage 
60TB RAID6 local storage

mitra: Bassik and Web/DB Server
24 core
256GB RAM 
500GB of SSD RAID0 storage 
36TB RAID6 local storage

vayu: Kundaje GPU server
4 core
64GB RAM 
200GB of SSD storage 
8TB RAID10 local storage
4 Nvidia GTX 970 4GB GPUs

amold: Bickel and SGE server
32 AMD core
128GB RAM 
200GB of SSD storage 
12TB RAID5 local storage

wotan: Bickel and SGE server
64 AMD core
256GB RAM 
200GB of SSD storage 
12TB RAID5 local storage

Filesystem:

/users/$USER
default home directory
full backups nightly 
nfs mount to dhara
should store code, papers, and other highly processed data here

/mnt/data/
globally accessible data
should store common data here
e.g. genomes and indexes, annotations, ENCODE data  
if you dont want this to count towards your quote you must chown

/mnt/lab_data/$LAB/
lab accessible data
should store lab project data here 
e.g. ATAC-seq prediction data, enhancer prediction, motif calls

/srv/scratch/$USER
fast local storage
not backed up, but on raid and data will never be deleted
most analysis should be performed here

/srv/persistent/$USER
fast local storage
synced nightly, but not backed up
       ie if the hard drives fail or you delete something and notice 
       within 24 hours we can recover. Otherwise not. (vs home which is 
       properly backed up )  
intermediate analysis products that would be hard to recover should be stored here 
       e.g. stochastic analysis results that need to be kept so that paper 
       results can be reproduced

/srv/www/$LABNAME/
web accessible from mitra.stanford.edu
*NOT BACKED UP*

Some parallel programming patterns:

# gzip a bunch of files
parallel gzip -- *.FILESTOGZIP

# fork example in python:
(for more detailed examples look at 
 https://github.com/nboley/grit/ grit/lib/multiprocessing_utils.py)

import os
import time
import random

import multiprocessing

class ProcessSafeOPStream( object ):
    def __init__( self, writeable_obj ):
        self.writeable_obj = writeable_obj
        self.lock = multiprocessing.Lock()
        self.name = self.writeable_obj.name
        return
    
    def write( self, data ):
        self.lock.acquire()
        self.writeable_obj.write( data )
        self.writeable_obj.flush()
        self.lock.release()
        return
    
    def close( self ):
        self.writeable_obj.close()

def worker(queue, ofp):
    # Try without this
    random.seed()
    while True:
        i = queue.get()
        if i == 'FINISHED': return
        # simulate an expensive function
        x = random.random()
        time.sleep(x/10)
        print i, x
        ofp.write("%i\t%s\n" % (i, x))

NSIMS = 10000
NPROC = 25

# populate queue
todo = multiprocessing.Queue()
for i in xrange(NSIMS): todo.put(i)
for i in xrange(NPROC): todo.put('FINISHED')

ofp = ProcessSafeOPStream( open("output.txt", "w") )

pids = []
for i in xrange(NPROC):
    pid = os.fork()
    if pid == 0:
       worker(todo, ofp)
       os._exit(0)
    else:
       pids.append(pid)  

for pid in pids:
    os.waitpid(pid, 0)

ofp.close()

print "FINISHED"

For use case 1 we obtained the following ENCODE and ROADMAP datasets https://www.encodeproject.org/files/ENCFF446WOD/@@download/ENCFF446WOD.bed.gz, https://www.encodeproject.org/files/ENCFF546PJU/@@download/ENCFF546PJU.bam, https://www.encodeproject.org/files/ENCFF059BEU/@@download/ENCFF059BEU.bam. Blacklisted regions were obtained from http://mitra.stanford.edu/kundaje/akundaje/release/blacklists/hg38-human/hg38.blacklist.bed.gz. The human genome version hg38 was obtained from http://hgdownload.cse.ucsc.edu/goldenPath/hg38/bigZips/hg38.fa.gz.

For use case 2 we used the set of narrowPeak files summarized in https://github.com/wkopp/janggu_usecases/tree/master/extra/urls.txt (archived version v1.0.1). The human genome version hg19 was obtained from http://hgdownload.cse.ucsc.edu/goldenPath/hg19/bigZips/hg19.fa.gz

For use case 3 we used the ENCODE datasets https://www.encodeproject.org/files/ENCFF591XCX/@@download/ENCFF591XCX.bam, https://www.encodeproject.org/files/ENCFF736LHE/@@download/ENCFF736LHE.bigWig, https://www.encodeproject.org/files/ENCFF177HHM/@@download/ENCFF177HHM.bam as we as the GENCODE annotation v29 from ftp://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_29/gencode.v29.annotation.gtf.gz.

Address of the bookmark: http://mitra.stanford.edu/

Ribbon: Visualizing complex genome alignments and structural variation:

Jit — Wed, 29 Nov 2017 07:40:22 -0600

Ribbon can be used for long reads, short reads, paired-end reads, and assembly/genome alignments. Instructions for each data format are available by clicking on "instructions" in each tab on the right.

Local installation:

You can install Ribbon locally from Github by following the instructions here: https://github.com/MariaNattestad/Ribbon

Address of the bookmark: http://genomeribbon.com/

jobTree based python wrapper to run the genome simulation tool suite Evolver

Jit — Fri, 08 Dec 2017 16:26:32 -0600

evolverSimControl (eSC) can be used to simulate multi-chromosome genome evolution on an arbitrary phylogeny (Newick format). In addition to simply running evolver, eSC also automatically creates statistical summaries of the simulation as it runs including text and image files. Also included are convenience scripts to: check on a running simulation and see detailed status and logging information; extract fasta sequence files from the leaf nodes of a completed simulation; extract pairwise multiple alignment files (.maf) from leaf and branch nodes from a completed simulation and with the help of mafJoin, join them together into a single maf covering the entire simulation.

Address of the bookmark: https://github.com/dentearl/evolverSimControl

String graph based genome assembly software and tools !

Rahul Nayak — Tue, 19 Dec 2017 17:17:38 -0600

In graph theory, a string graph is an intersection graph of curves in the plane; each curve is called a "string". String graphs were first proposed by E. W. Myers in a 2005 publication. In recent Genome Research paper describing an innovative approach for assembling large genomes from NGS data caught our attention for several reasons. i) it give different "string graph" prospective of long lasting genome assembly problem ii) the paper is coauthored by Jared Simpson, the developer of ABySS assembler and Richard Durbin. iii) Simpson-Durbin algorithm is that it does not rely on de Bruijn graphs, and instead employs a different graph construction approach called ‘string graph’.

Following are the genome assembly tools based on string graph:

1.SGA (String Graph Assembler) https://github.com/jts/sga

Assembles large genomes from high coverage short read data. SGA is designed as a modular set of programs, which are used to form an assembly pipeline. SGA implements a set of assembly algorithms based on the FM-index. As the FM-index is a compressed data structure, the algorithms are very memory efficient. The SGA assembly has three distinct phases. The first phase corrects base calling errors in the reads. The second phase assembles contigs from the corrected reads. The third phase uses paired end and/or mate pair data to build scaffolds from the contigs. The output of this software is a PDF report that allows the properties of the genome and data quality to be visually explored. By providing more information to the user at the start of an assembly project, this software will help increase awareness of the factors that make a given assembly easy or difficult, assist in the selection of software and parameters and help to troubleshoot an assembly if it runs into problems.

2. SAGE: String-overlap Assembly of GEnomes https://github.com/lucian-ilie/SAGE2

SAGE, for de novo genome assembly. As opposed to most assemblers, which are de Bruijn graph based, SAGE uses the string-overlap graph. SAGE builds upon great existing work on string-overlap graph and maximum likelihood assembly, bringing an important number of new ideas, such as the efficient computation of the transitive reduction of the string overlap graph, the use of (generalized) edge multiplicity statistics for more accurate estimation of read copy counts, and the improved use of mate pairs and min-cost flow for supporting edge merging. The assemblies produced by SAGE for several short and medium-size genomes compared favourably with those of existing leading assemblers.

3. FSG: Fast String Graph

The new integrated assembler has been assessed on a standard benchmark, showing that fast string graph (FSG) is significantly faster than SGA while maintaining a moderate use of main memory, and showing practical advantages in running FSG on multiple threads. Moreover, we have studied the effect of coverage rates on the running times.

4. BASE https://github.com/dhlbh/BASE

It enhances the classic seed-extension approach by indexing the reads efficiently to generate adaptive seeds that have high probability to appear uniquely in the genome. Such seeds form the basis for BASE to build extension trees and then to use reverse validation to remove the branches based on read coverage and paired-end information, resulting in high-quality consensus sequences of reads sharing the seeds. Such consensus sequences are then extended to contigs. BASE is a practically efficient tool for constructing contig, with significant improvement in quality for long NGS reads. It is relatively easy to extend BASE to include scaffolding.

5. Fermi https://github.com/lh3/fermi/

Fermi is a de novo assembler with a particular focus on assembling Illumina short sequence reads from a mammal-sized genome. In addition to the role of a typical assembler, fermi also aims to preserve heterozygotes which are often collapsed by other assemblers. Its ultimate goal is to find a minimal set of unitigs to represent all the information in raw reads.

If you want to learn about String Graph assembler, please read the following papers -

i) The Fragment Assembly String Graph - E. W. Myers

This paper describes the String Graph concept.

ii) Efficient construction of an assembly string graph using the FM-index - Jared T. Simpson and Richard Durbin

This earlier paper from Simpson and Durbin

iii) Efficient de novo assembly of large genomes using compressed data structures - Jared T. Simpson and Richard Durbin

AliTV—interactive visualization of whole genome comparisons

Jit — Wed, 10 Jan 2018 07:08:17 -0600

AliTV, which provides interactive visualization of whole genome alignments. AliTV reads multiple whole genome alignments or automatically generates alignments from the provided data. Optional feature annotations and phylo- genetic information are supported. The user-friendly, web-browser based and highly customizable interface allows rapid exploration and manipulation of the visualized data as well as the export of publication-ready high-quality figures. AliTV is freely available at https://github.com/AliTVTeam/AliTV

https://alitvteam.github.io/AliTV/

Address of the bookmark: https://github.com/AliTVTeam/AliTV

GenomeTools: The versatile open source genome analysis software

Jit — Wed, 07 Feb 2018 10:44:18 -0600

The GenomeTools genome analysis system is a free collection of bioinformatics tools (in the realm of genome informatics) combined into a single binary named gt. It is based on a C library named “libgenometools” which consists of several modules.

If you are interested in gene prediction, have a look at GenomeThreader.

Address of the bookmark: http://genometools.org/

AlignGraph: algorithm for secondary de novo genome assembly guided by closely related references

Manisha Mishra — Tue, 17 Apr 2018 16:21:20 -0500

AlignGraph is a software that extends and joins contigs or scaffolds by reassembling them with help provided by a reference genome of a closely related organism.

Using AlignGraph

AlignGraph --read1 reads_1.fa --read2 reads_2.fa --contig contigs.fa --genome genome.fa --distanceLow distanceLow --distanceHigh distancehigh --extendedContig extendedContigs.fa --remainingContig remainingContigs.fa [--kMer k --insertVariation insertVariation --coverage coverage --part p --fastMap --ratioCheck --iterativeMap --misassemblyRemoval --resume]

Address of the bookmark: https://github.com/baoe/AlignGraph

CrossMap: a program for convenient conversion of genome coordinates

Jit — Thu, 31 May 2018 06:00:47 -0500

CrossMap is a program for convenient conversion of genome coordinates (or annotation files) between different assemblies (such as Human hg18 (NCBI36) <> hg19 (GRCh37), Mouse mm9 (MGSCv37) <> mm10 (GRCm38)). It supports most commonly used file formats including SAM/BAM, Wiggle/BigWig, BED, GFF/GTF, VCF. CrossMap is designed to liftover genome coordinates between assemblies. It’s not a program for aligning sequences to reference genome. We do not recommend using CrossMap to convert genome coordinates between species.

Address of the bookmark: http://crossmap.sourceforge.net

assemblytics: delta file to analyze alignments of an assembly to another assembly or a reference genome

Jit — Thu, 14 Jun 2018 07:31:00 -0500

Download and install MUMmer Align your assembly to a reference genome using nucmer (from MUMmer package) $ nucmer -maxmatch -l 100 -c 500 REFERENCE.fa ASSEMBLY.fa -prefix OUT Consult the MUMmer manual if you encounter problems Optional: Gzip the delta file to speed up upload (usually 2-4X faster) $ gzip OUT.delta Then use the OUT.delta.gz file for upload. Upload the .delta or delta.gz file (view example) to Assemblytics Important: Use only contigs rather than scaffolds from the assembly. This will prevent false positives when the number of Ns in the scaffolded sequence does not match perfectly to the distance in the reference. The unique sequence length required represents an anchor for determining if a sequence is unique enough to safely call variants from, which is an alternative to the mapping quality filter for read alignment. http://assemblytics.com/

Address of the bookmark: http://assemblytics.com/

LINKS scaffolder bloomfilter setting !

Jit — Fri, 15 Jun 2018 10:39:54 -0500

➜ bin git:(master) ✗ ls -l
total 68
drwxrwxr-x 3 urbe urbe 4096 Jun 15 12:15 lib
-rwxrwxrwx 1 urbe urbe 65141 Jun 15 17:13 LINKS
➜ bin git:(master) ✗ pwd
/home/urbe/Tools/LINKS_1.8.6/bin

➜ bloomfilter git:(master) ✗ swig -Wall -c++ -perl5 BloomFilter.i
➜ bloomfilter git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
BloomFilter_wrap.cxx:1892:30: fatal error: ../BloomFilter.hpp: No such file or directory
compilation terminated.
➜ bloomfilter git:(master) ✗ cd swig
➜ swig git:(master) ✗ g++ -c BloomFilter_wrap.cxx -I/home/urbe/anaconda3/lib/perl5/5.22.0/x86_64-linux-thread-multi/CORE/ -fPIC -Dbool=char -O3
In file included from BloomFilter_wrap.cxx:1877:0:
../BloomFilter.hpp: In member function ‘void BloomFilter::loadHeader(FILE*)’:
../BloomFilter.hpp:141:59: warning: ignoring return value of ‘size_t fread(void*, size_t, size_t, FILE*)’, declared with attribute warn_unused_result [-Wunused-result]
fread(&header, sizeof(struct FileHeader), 1, file);
^
➜ swig git:(master) ✗ g++ -Wall -shared BloomFilter_wrap.o -o BloomFilter.so -O3
➜ swig git:(master) ✗ cd ..
➜ bloomfilter git:(master) ✗ cd ..
➜ lib git:(master) ✗ cd ..
➜ bin git:(master) ✗ ./LINKS
Usage: ./LINKS [v1.8.6]
-f sequences to scaffold (Multi-FASTA format, required)
-s file-of-filenames, full path to long sequence reads or MPET pairs [see below] (Multi-FASTA/fastq format, required)
-m MPET reads (default -m 1 = yes, default = no, optional)
! DO NOT SET IF NOT USING MPET. WHEN SET, LINKS WILL EXPECT A SPECIAL FORMAT UNDER -s
! Paired MPET reads in their original outward orientation <- -> must be separated by ":"
>template_name
ACGACACTATGCATAAGCAGACGAGCAGCGACGCAGCACG:ATATATAGCGCACGACGCAGCACAGCAGCAGACGAC
-d distance between k-mer pairs (ie. target distances to re-scaffold on. default -d 4000, optional)
Multiple distances are separated by comma. eg. -d 500,1000,2000,3000
-k k-mer value (default -k 15, optional)
-t step of sliding window when extracting k-mer pairs from long reads (default -t 2, optional)
Multiple steps are separated by comma. eg. -t 10,5
-o offset position for extracting k-mer pairs (default -o 0, optional)
-e error (%) allowed on -d distance e.g. -e 0.1 == distance +/- 10% (default -e 0.1, optional)
-l minimum number of links (k-mer pairs) to compute scaffold (default -l 5, optional)
-a maximum link ratio between two best contig pairs (default -a 0.3, optional)
*higher values lead to least accurate scaffolding*
-z minimum contig length to consider for scaffolding (default -z 500, optional)
-b base name for your output files (optional)
-r Bloom filter input file for sequences supplied in -s (optional, if none provided will output to .bloom)
NOTE: BLOOM FILTER MUST BE DERIVED FROM THE SAME FILE SUPPLIED IN -f WITH SAME -k VALUE
IF YOU DO NOT SUPPLY A BLOOM FILTER, ONE WILL BE CREATED (.bloom)
-p Bloom filter false positive rate (default -p 0.001, optional; increase to prevent memory allocation errors)
-x Turn off Bloom filter functionality (-x 1 = yes, default = no, optional)
-v Runs in verbose mode (-v 1 = yes, default = no, optional)

Error: Missing mandatory options -f and -s.

ERROR fixed

perl: symbol lookup error: /home/urbe/Tools/LINKS_new/bin/./lib/bloomfilter/swig/BloomFilter.so: undefined symbol: Perl_Gthr_key_ptr