A fairly complete on-line guide to BLAST searching can be found at the NCBI BLAST Help Manual. For a theoretical overview of BLAST, see the NCBI BLAST Course. Additional information can be found in the BLAST 2.0 Release Notes

Supported and Suggested Values for Gap Open and Extension in BLASTP, BLASTX, TBLASTN, and TBLASTX

Address of the bookmark: https://www.arabidopsis.org/Blast/BLASToptions.jsp

Check out the changes they made.

They added the cleanup-blastdb-volumes.py script to remove unused BLAST database volumes. Read the documentation here.

They also switched the protocol from ftp to https to access BLAST databases for increased performance and reliability when downloading data from the NCBI with the update_blastdb.pl script.

And fixed a few bugs related to downloading data from the NCBI, and mt_mode crashing blastn and blastx.

Check out the release notes.

Download BLAST+ 2.14.1

Questions or comments? Please write the BLAST help desk.

More info and download: https://blast.ncbi.nlm.nih.gov/doc/blast-news/2023-BLAST-News.html

Step 1: Install BLAST

1. Download BLAST:

   • Visit the NCBI BLAST+ download page to download the appropriate version for your operating system (Windows, macOS, or Linux).

2. Install BLAST:

   • Extract the downloaded archive. For Linux/Mac, use:

     tar -xvzf ncbi-blast-*.tar.gz
     cd ncbi-blast-*
     

   • Add the BLAST binary folder to your system PATH for easier access:

     export PATH=$PATH:/path/to/ncbi-blast-*/bin
     

3. Verify Installation:
   Run the following command to ensure BLAST is installed correctly:

   blastn -version
   

Step 2: Prepare a Local Database

To run BLAST offline, you’ll need a sequence database.

1. Download a Pre-Built Database (Optional):

   • NCBI provides ready-to-use databases such as nt, nr, and Swiss-Prot. Use the update_blastdb.pl script (bundled with BLAST) to download these:

     update_blastdb.pl --decompress nt
     

2. Create a Custom Database:
   If you have specific sequences to use as a database:

   • Prepare a FASTA file containing the sequences.
   • Use makeblastdb to create a database:

     makeblastdb -in your_sequences.fasta -dbtype [nucl|prot] -out custom_db
     

     Replace [nucl|prot] with nucl for nucleotide sequences or prot for protein sequences.

Step 3: Prepare the Query Sequence

• Save your query sequence(s) in FASTA format.
• Ensure the file is properly formatted, with a header line starting with > followed by the sequence name, and the sequence on subsequent lines.

Example:

>query_sequence
ATGCGTAGCTAGCGTAGCTAGCTAGCTA

Step 4: Run BLAST

1. Choose the Appropriate BLAST Tool:
   Depending on your data type:

   • blastn: For nucleotide-nucleotide searches.
   • blastp: For protein-protein searches.
   • blastx: Translates nucleotide sequences into proteins and compares them to a protein database.
   • tblastn: Compares protein sequences to a nucleotide database.
   • tblastx: Translates both nucleotide query and database sequences.

2. Run the Command:
   Example command for blastn:

   blastn -query query.fasta -db custom_db -out results.txt -outfmt 6 -evalue 1e-5
   

   Explanation of Parameters:

   • -query: Specifies the query file.
   • -db: Points to the local database.
   • -out: Output file name.
   • -outfmt: Output format (e.g., 6 for tabular format).
   • -evalue: E-value cutoff for significance.

Step 5: Interpret Results

1. Output Formats:

   • Default (outfmt 0): Human-readable format.
   • Tabular (outfmt 6): Includes fields like query ID, subject ID, percent identity, alignment length, etc.

2. Analyze Results:
   Use tools like grep, Python, or R to parse and filter results for downstream analysis.

Step 6: Optimize Performance

For large datasets, BLAST can be resource-intensive. To improve performance:

1. Multithreading:
   Use the -num_threads option to leverage multiple CPU cores:

   blastn -query query.fasta -db custom_db -out results.txt -num_threads 4
   

2. Database Subsetting:
   Split large databases into smaller chunks for faster searches.

3. Adjust Parameters:

   • Lower the -evalue threshold for stricter matches.
   • Use -max_target_seqs to limit the number of results per query.

Step 7: Update Databases (Optional)

If using NCBI databases, regularly update them to ensure the inclusion of the latest sequences:

update_blastdb.pl --decompress nt

Conclusion

Running BLAST offline is a straightforward process that offers flexibility and security for bioinformaticians working with sensitive data. By following this guide, you can harness the power of BLAST to analyze sequences efficiently and gain valuable biological insights.

For advanced use cases, explore BLAST’s customization options, such as custom scoring matrices, filtering, and iterative searches with tools like PSI-BLAST. Happy BLASTing!

sudo /etc/init.d/apache2 stop

sudo /etc/init.d/mysql stop

sudo /etc/init.d/proftpd stop

sudo /opt/lampp/lampp start

PhpMyAdmin “Wrong permissions on configuration file, should not be world writable!”

Once the Xammp is installed, it might be possible to set up the configuration file in writable mode. Try the following steps:

Just chmod 0755 the file

sudo chmod 0755 config.inc.php

Address of the bookmark: http://4dgenome.research.chop.edu/

Address of the bookmark: https://reactome.org/

Sequence Analysis and General Bioinformatics

• BLAST, Ian Korf, Mark Yandell, Joseph Bedell, 2003, O'Reilly
• Sequence Analysis in a Nutshell: A Guide to Common Tools and Databases, Scott Markel, Darryl Leon, 2003, O'Reilly
• Bioinformatics for Geneticists, Michael Barnes, Ian C Gray (Editors), 2003, John Wiley & Sons
• Bioinformatics for Dummies, Jean-Michel Claverie, Cedric Notredame, 2003, John Wiley & Sons
• Mathematics of Genome Analysis, Jerome K. Percus, 2002, Cambridge Univ Press
• Bioinformatics Computing, Bryan P. Bergeron, 2002, Prentice Hall
• Evolutionary Computation in Bioinformatics, Gary B. Fogel, David W. Corne (Editors), 2002, Morgan Kaufmann
• Introduction to Bioinformatics, Arthur M. Lesk, 2002, Oxford University Press
• Instant Notes in Bioinformatics, D.R. Westhead, J. H. Parish, R.M. Twyman, 2002, Bios Scientific Pub
• Fundamental Concepts of Bioinformatics, Dan E. Krane, Michael L. Raymer, Michaeel L. Raymer, Elaine Nicpon Marieb, 2002, Benjamin/Cummings
• Essentials of Genomics and Bioinformatics, C. W. Sensen (Editor), 2002, John Wiley & Sons
• Current Topics in Computational Molecular Biology (Computational Molecular Biology), Tao Jiang, Ying Xu, Michael Zhang (Editors), 2002, MIT Press
• Hidden Markov Models for Bioinformatics, Timo Koski, Timo Koskinen, 2001, Kluwer Academic Publishers
• Bioinformatics: From Genomes to Drugs, Thomas Lengauer (Editor), 2001, John Wiley & Sons
• Statistical Methods in Bioinformatics: An Introduction (Statistics for Biology and Health), Warren Ewens, Gregory Grant, 2001, Springer Verlag
• Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Second Edition, Andreas D. Baxevanis, B. F. Francis Ouellette, 2001, Wiley-Interscience
• Bioinformatics: The Machine Learning Approach, Second Edition (Adaptive Computation and Machine Learning), Pierre Baldi, Soren Brunak, Sren Brunak, 2001, MIT Press
• Introduction to Bioinformatics, T eresa Attwood, David Parry-Smith, 2001, Prentice Hall
• Bioinformatics: A Primer, Charles Staben, 2001, Jones & Bartlett Pub
• Data Analysis and Classification for Bioinformatics, Arun Jagota, 2000, AKJ Academics
• Bioinformatics: Sequence and Genome Analysis, David W. Mount, 2001, Cold Spring Harbor Laboratory Press
• Bioinformatics: A Biologist's Guide to Biocomputing and the Internet, Stuart M. Brown, 2000, Eaton Pub Co
• Bioinformatics: Sequence, Structure and Databanks: A Practical Approach (The Practical Approach Series, 236), Des Higgins (Editor), Willie Taylor (Editor), 2000, Oxford Univ Press
• Neural Networks and Genome Informatics, Cathy H. Wu, Jerry W. McLarty, 2000, Elsevier Science
• Computational Molecular Biology: An Introduction (Wiley Series in Mathematical and Computational Biology), Peter Clote and Rolf Backofen, 2000, John Wiley & Sons
• Computational Molecular Biology: An Algorithmic Approach, Pavel A. Pevzner, 2000, MIT Press
• Post-Genome Informatics, Minoru Kanehisa, 2000, Oxford Univ Press
• Mathematical and Computational Biology: Computational Morphogenesis, Hierarchical Complexity, and Digital Evolution, Chrystopher L. Nehaniv, 1999, American Mathematical Society
• Pattern Discovery in Biomolecular Data: Tools, Techniques, and Applications, Jason T. L. Wang, Bruce A. Shapiro, Dennis Elliott Shasha (Editors), 1999, Oxford Univ Press
• Time Warps, String Edits, and Macromolecules: The Theory and Practice of Sequence Comparison, David Sankoff and Joseph Kruskal (Editors), 1999, Cambridge University Press
• Bioinformatics Basics: Applications in Biological Science and Medicine, Hooman Rashidi, 1999, CRC Press
• Bioinformatics: Methods and Protocols (Methods in Molecular Biology, Vol 132), Stephen Misener and Stephen A. Krawetz (Editors),1999, Humana Press
• Bioinformatics: Databases and Systems, Stanley Letovsky (Editor),1999, Kluwer Academic Publishers
• Computational Molecular Biology, P. Green, 1998, Blackwell Science Inc.
• Computational Methods in Molecular Biology (New Comprehensive Biochemistry, V. 32), Steven L. Salzberg, David B. Searls, Simon Kasif (Editors), 1998, Elsevier Science Ltd.
• Biological Sequence Analysis: Probabilistic Models of Proteins and Nucleic Acids, Richard Durbin, S. Eddy, A. Krogh, G. Mitchison, 1998, Cambridge University Press
• Guide to Human Genome Computing, M. J. Bishop (Editor), 1998, Academic Press
• Introduction to Computational Molecular Biology, Joao Meidanis, Joao C. Setabal, 1997, PWS Pub. Co.
• Algorithms on Strings, Trees, and Sequences: Computer Science and Computational Biology, Dan Gusfield, 1997, Cambridge University Press
• Sequence Data Analysis Guidebook, Simon R. Swindell (Editor), 1997, Humana Press
• High Performance Computational Methods for Biological Sequence Analysis, Tieng K. Yap, Ophir Frieder, Robert L. Martino, 1996, Kluwer Academic Pub.
• Computer Methods for Macromolecular Sequence Analysis, Methods in Enzymology, volume 266, Russell F. Doolittle (Editor), 1996, Academic Press
• DNA and Protein Sequence Analysis: A Practical Approach (Practical Approach Series , No 171), 1996, M. J. Bishop and C. J. Rawlings (Editors), 1996, IRL Press
• Molecular Bioinformatics: Algorithms and Applications, Steffen Schulze-Kremer, 1995, Walter De Gruyter
• Introduction to Computational Biology - Maps, sequences and genomes, Michael S. Waterman, 1995, Chapman & Hall
• Computer Analysis of Sequence Data, Annette M. Griffin and Hugh G. Griffin (Editors), 1994, Humana Press
• Artificial Intelligence and Molecular Biology, Lawrence Hunter (Editor), 1993, AAAI Press
• Sequence Analysis Primer, Michael Gribskov and John Devereux (Editors), 1992, Oxford University Press
• Mathematical Methods of Analysis of Biopolymer Sequences (Dimacs Series in Discrete Mathematics and Theoretical Computer Science ; Volume 8), S. G. Gindikin, 1992, American Mathematical Society
• Mathematical Methods for DNA Sequences, Michael S. Waterman (Editor), 1989, CRC Press

Programming Books for Bioinformatics

• Mastering Perl for Bioinformatics, James D. Tisdall, 2003, O'Reilly
• Genomic Perl: From Bioinformatics Basics to Working Code, Rex A. Dwyer, 2002, Cambridge University Press
• Beginning Perl for Bioinformatics, James Tisdall, 2001, O'Reilly
• Developing Bioinformatics Computer Skills, Cynthia Gibas, Per Jambeck, 2001, O'Reilly

General Genomics

• Functional Microbial Genomics (Volume 33), Brendan Wren, Nick Dorrell, 2003, Academic Press
• Discovering Genomics, Proteomics, and Bioinformatics, A. Malcolm Campbell, Laurie J. Heyer, 2002, Benjamin/Cummings
• Genomes, Terence A. Brown, 2002, John Wiley & Sons
• Essentials of Medical Genomics, Stuart M. Brown , 2002, John Wiley & Sons
• A Primer of Genome Science, Greg Gibson, Spencer V. Muse, 2002, Sinauer Associates
• Pathogen Genomics: Impact on Human Health, Karen Joy, Phd Shaw (Editors), 2002, Humana Press
• Genomics, John E. Antonopoulos, 2000, Xlibris Corporation
• Genomics and Proteomics: Functional and Computational Aspects, Sandor Suhai (Editor), 2000, Plenum Pub Corp
• Functional Genomics: A Practical Approach (The Practical Approach Series, 235), S. Hunt and F. Livesey (Editors), 2000, Oxford Univ Press
• Human Molecular Genetics, Andrew P. Read, Tom Strachan 1999, BIOS Scientific Publishers Ltd.
• Genomics: The Science and Technology Behind the Human Genome Project, Charles R. Cantor and Cassandra L. Smith, 1999, John Wiley & Sons
• Cells: A Laboratory Manual, 3 volumes, David L. Spector, Robert D. Goldman, Leslie A. Leinwand, 1998, Cold Spring Harbor Laboratory Press
• Genome Analysis: A Laboratory Manual, 4 volumes, Bruce Birren, et al. (Editors), 1997, Cold Spring Harbor Laboratory Press
• The Human Genome Project, N. G. Cooper (Editor), 1994, University Science Books

Comparative Genomics

• Handbook of Comparative Genomics: Principles and Methodology, Cecilia Saccone, Graziano Pesole, 2003, Wiley-Liss
• Sequence - Evolution - Function: Computational Approaches in Comparative Genomics, Eugene V. Koonin, Michael Y. Galperin, 2002, Kluwer Academic Publishers
• Comparative Genomics - Empirical and Analytical Approaches to Gene Order Dynamics, Map Alignment and the Evolution of Gene Families, David Sankoff and Joseph H. Nadeau, 2000, Kluwer Academic Pub
• Comparative Genomics, Melody Clark (Editor), 2000, Kluwer Academic Pub

Proteomics

• Proteins and Proteomics: A Laboratory Manual, Richard J. Simpson (Editor), Cold Spring Harbor Laboratory
• Proteomics in Practice: A Laboratory Manual of Proteome Analysis , Reiner Westermeier, Tom Naven, 2002, John Wiley & Sons
• Posttranslational Modifications of Proteins: Tools for Functional Proteomics (Methods in Molecular Biology, Vol 194) , Christoph Kannicht (Editor), 2002, Humana Press
• Peptide Arrays on Membrane Supports: Synthesis and Applications (Springer Lab Manual), Joachim Koch, Michael Mahler (Editors), 2002, Springer Verlag
• Proteomics , Timothy Palzkill, 2002, Kluwer Academic Publishers
• Introduction to Proteomics: Tools for the New Biology , Daniel C. Liebler (Editor), 2001, Humana Press
• Proteome Research: Mass Spectrometry (Principles and Practice) , P. James (Editor), 2001, Springer Verlag
• Interpreting Protein Mass Spectra: A Comprehensive Resource , A. Peter Snyder, 2000, American Chemical Society
• Protein Sequencing and Identification Using Tandem Mass Spectrometry , Michael Kinter, Nicholas E. Sherman, 2000, Wiley-Interscience
• From Genome to Proteome: Advances in the Practice and Application of Proteomics, Michael J. Dunn (Editor), 2000, Vch Verlagsgesellschaft Mbh
• Proteomics: From Protein Sequence to Function, S. Pennington (Editor), M. Dunn (Editor), 2000, Springer Verlag
• Proteome Research: Two-Dimensional Gel Electrophoresis and Detection Methods (Principles and Practice), T. Rabilloud (Editor), 2000, Springer Verlag
• Proteome and Protein Analysis, R. M. Kamp, D. Kyriakidis, th Choli-Papadopoulou (Editor), 1999, Springer Verlag
• Proteome Research: New Frontiers in Functional Genomics, M. R. Wilkins, et al. (Editors), 1997, Springer Verlag

Protein Structure

• Structural Bioinformatics, Philip E. Bourne, Helge Weissig (Editors), 2003, John Wiley & Sons
• Protein Structure Prediction: Bioinfomatic Approach, I.F. Tsigelny, 2002, International University Line
• Introduction to Protein Architecture: The Structural Biology of Proteins, Arthur M. Lesk, 2001, Oxford University Press
• Protein Structure Prediction: Methods and Protocols, David M. Webster (Editor), 2000, Humana Press
• Introduction to Protein Structure, Carl-Ivar Branden, John Tooze, 1999, Garland Publishing
• Structure and Mechanism in Protein Science: A Guide to Enzyme Catalysis and Protein Folding, Alan Fersht, 1999, Freeman

Pharmacogenomics

• Pharmacogenomics: Social, Ethical, and Clinical Dimensions, Mark A. Rothstein (Editor), 2003, Wiley-Liss
• Pharmacogenomics: The Search for Individualized Therapies, Julio Licinio, Ma-Li Wong (Editors), 2002, John Wiley & Sons
• Pharmacogenomics, Werner Kalow, Urs A. Meyer, Rachel Tyndale (Editors), 2001, Marcel Dekker
• Pharmacogenetics and Pharmcogenomics: Recent Conceptual and Technical Advances (Pharmacology, Volume 61, Number 3, 2000), Elliot S. Vesell (Editor), 2000, S. Karger Publishing
• Pharmacogenetics, Wendell Weber, 1997, Oxford University Press

DNA Microarrays

• Statistical Analysis of Gene Expression Microarray Data, T. P. Speed (Editor), 2003, CRC Press
• Microarray Gene Expression Data Analysis: A Beginner's Guide, Helen C. Causton, John Quackenbush, Alvis Brazma, 2003, Blackwell Publishers
• The Analysis of Gene Expression Data (Statistics for Biology and Health), G. Parmigiani, E. S. Garrett, R. A. Irizarry, S. Zeger , Graeme Clark (Editors), 2003, Springer Verlag
• A Practical Approach to Microarray Data Analysis, Daniel P. Berrar, Werner Dubitzky, Martin Granzow (Editors), 2002, Kluwer Academic Publishers
• DNA Microarrays and Gene Expression: From Experiments to Data Analysis and Modeling, Pierre Baldi, G. Wesley Hatfield, 2002, Cambridge University Press
• DNA Microarrays: A Molecular Cloning Manual, David Bowtell, Joseph Sambrook (Editors), 2002, Cold Spring Harbor Laboratory
• DNA Array Image Analysis: Nuts & Bolts, Gerda Kamberova, Shishir Shah, 2002, DNA Press
• Microarray Analysis, Mark Schena, 2002, John Wiley & Sons
• A Biologist's Guide to Analysis of DNA Microarray Data, Steen Knudsen, 2002, John Wiley & Sons
• Microarrays for an Integrative Genomics (Computational Molecular Biology), Isaac S. Kohane, Alvin Kho, Atul J. Butte, 2002, MIT Press
• Microarrays for the Neurosciences: An Essential Guide (Cellular and Molecular Neuroscience), Daniel H. Geschwind, Jeffrey P. Gregg (Editors), 2002, MIT Press
• DNA Microarrays: Gene Expression Applications, Bertrand Jordan (Editor), 2001, Springer Verlag
• DNA Arrays: Methods and Protocols (Methods in Molecular Biology, Volume 170), Jang B. Rampal (Editor), 2001, Humana Press
• DNA Arrays: Technologies and Experimental Strategies, Elena V. Grigorenko (Editor), 2001, CRC Press
• Microarray Biochip Technology, Mark Schena (Editor), 2000, Eaton Pub
• Expression Genetics: Accelerated and High-Throughput Methods (Biotechniques Update Series), Michael McClelland (Editor), Arthur B. Pardee (Editor), 1999, Eaton Pub
• DNA Microarrays: A Practical Approach (Practical Approach Series 205), Mark Schena (Editor), 1999, Oxford Univ Press
• cDNA Preparation and Characterization (Methods in Enzymology Volume 303), S.M. Weissman (Editor), 1999, Academic Press

Systems Biology, Genetic and Biochemical Network

• Handbook of Graphs and Networks : From the Genome to the Internet, Stefan Bornholdt, Heinz Georg Schuster (Editors), 2003, Vch Verlagsgesellschaft Mbh
• Computational Cell Biology, Christopher Fall, Eric Marland, John Wagner, John Tyson (Editors), 2002, Springer Verlag
• Gene Regulation and Metabolism: Post-Genomic Computational Approaches (Computational Molecular Biology), Julio Collado-Vides, Ralf Hofestadt (Editors), 2002, MIT Press
• Foundations of Systems Biology, Hiroaki Kitano (Editor), 2001, MIT Press
• Genomic Regulatory Systems: Development and Evolution, Eric H. Davidson , 2001, Academic Press
• Genes & Signals, Mark Ptashne, Alexander Gann, 2001, Cold Spring Harbor Laboratory
• Computational Modeling of Genetic and Biochemical Networks (Computational Molecular Biology), James M. Bower and Hamid Bolouri (Editors), 2001, MIT Press
• Protein-Protein Interactions: A Molecular Cloning Manual, Erica Golemis (Editor), 2001, Cold Spring Harbor Laboratory
• Computational Analysis of Biochemical Systems: A Practical Guide for Biochemists and Molecular Biologists, Eberhard O. Voit, 2000, Cambridge University Press
• Mathematical Physiology, James P. Keener, James Sneyd, 1998, Springer Verlag

DNA Sequencing

• DNA Sequencing: From Experimental Methods to Bioinformatics (Introduction to Biotechniques Series), Luke Alphey, 1997, Springer Verlag
• Automated DNA sequencing and analysis, Adams M.D., Fields C., Venter J.C. (Editors), 1994, Academic Press

Apart from above mentioned books, you can also find some useful books links at following mentioned URLs:

http://www.amazon.com/Biological-Sequence-Analysis-Probabilistic-Proteins/dp/0521629713

http://www.amazon.com/Bioinformatics-Genes-Proteins-Computers-Advanced/dp/1859960545

http://www.amazon.com/Introduction-Bioinformatics-Algorithms-Computational-Molecular/dp/0262101068

http://books.google.no/books?id=pxSM7R1sdeQC&dq=Pierre+baldi+%2B+bioinformatics&printsec=frontcover&source=bn&hl=en&ei=IoGRS6uCIJT-NYLA8Z0N&sa=X&oi=book_result&ct=result&redir_esc=y#v=onepage&q&f=false

http://www.amazon.com/Statistical-Methods-Bioinformatics-Introduction-Statistics/dp/0387400826

If you think your favourite books are not listed then please write it down in comment section for the benefits of other users. Feel free to add many more books in comment section. 

https://www.ncbi.nlm.nih.gov/pubmed/29315358

Address of the bookmark: http://lpa.saogabriel.unipampa.edu.br:8080/httdatabase/

More at https://software.broadinstitute.org/gatk/download/bundle

ftp://ftp.ncbi.nlm.nih.gov/snp/organisms/human_9606/VCF/GATK/.

ftp://ftp.broadinstitute.org/bundle/hg38/hg38bundle/

Address of the bookmark: https://console.cloud.google.com/storage/browser/genomics-public-data/resources/broad/hg38/v0?pli=1

More recently, we've been enthused about using k-mer based similarity measures and computing and searching k-mer-based sketch search databases for all the things.

But I haven't spent too much talking about using k-mers for taxonomy, although that has become an ahem area of interest recently, if you read into our papers a bit.

In this blog post I'm going to fix this by doing a little bit of a literature review and waxing enthusiastic about other people's work. Then in a future blog post I'll talk about how we're building off of this work in fun! and interesting? ways!

Address of the bookmark: http://ivory.idyll.org/blog/2017-something-about-kmers.html